RegulonDB RegulonDB 10.9: Gene Sequence
ompN gene sequence


Size: 1134        A: 312  T: 293  G: 276  C: 253

Fasta

 

>ompN E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagcaaagtactggcacttttaattcctgccctgctcgccgcaggtgctgcacat
gcagccgaagtttataataaagacggcaacaaattagatctgtatggcaaagttgatggc
ctgcattatttttctgataattcagcgaaagatggcgaccagagctatgcgcgtctgggt
tttaaaggcgaaacccaaattaacgatcaactcactggctacggtcaatgggaatacaat
attcaggcaaacaacactgaatcttcaaaaaaccagtcatggacccgtctggcatttgcc
gggctgaaatttgcagattacggttctttcgattacggacgtaattatggcgtaatgtac
gacatcgaaggctggaccgatatgctgcctgaatttggcggtgactcttataccaatgca
gacaactttatgactggtcgagccaatggcgtcgcgacttatcgtaatactgatttcttc
ggtctggtaaatggtctgaacttcgcggtgcagtatcaaggtaacaacgaaggagccagt
aatggtcaggaaggcaccaacaacggacgtgatgttcgccatgaaaacggtgacggctgg
ggtctttccacaacatatgatttaggcatgggctttagcgctggtgcggcatacacctct
tctgaccgcaccaatgaccaggttaaccatactgcggcgggtggtgataaagcagacgcg
tggactgctgggctaaaatacgatgctaacaatatttacctggcaaccatgtattcagaa
acgcgtaatatgaccccgtttggcgacagcgattatgctgtggcaaacaaaacccagaat
tttgaagtcactgcacagtaccagtttgattttggtctgcgtccggcagtctctttcctg
atgtctaaaggccgtgacctgcacgctgcgggtggtgcagacaacccggcaggtgttgat
gataaagatctggttaaatacgccgatattggcgcgacttactatttcaataaaaacatg
tccacctacgttgactataaaatcaacctgttggatgaagatgacagcttctacgctgcc
aatggcatctctaccgatgatattgtcgctttaggtctggtttatcagttctaa
              
                            

Download fasta file
RegulonDB