RegulonDB RegulonDB 10.9: Gene Sequence
ydbK gene sequence


Size: 3525        A: 831  T: 817  G: 945  C: 932

Fasta

 

>ydbK E. coli K12. Version NC_000913.3 GI:556503834
atgattactattgacggtaatggcgcggttgcttcggtcgcatttcgcaccagtgaagtt
atcgccatctaccctattacccccagttccacgatggcagaacaggctgatgcctgggcc
ggaaacggcttaaagaacgtttggggagacacaccacgcgtggttgaaatgcagtcggaa
gcgggtgctatcgctaccgtgcatggcgctttgcagacgggtgccctttcaacatcgttt
acgtcatcgcagggtttgctgctgatgatcccgacgctgtacaaactggcaggcgaacta
acaccgtttgtcctgcatgtagcggcacgtaccgttgccacacatgcactctctattttt
ggcgatcattccgacgttatggcggtgcgccagacgggttgcgcgatgttgtgtgcagca
aacgtccaggaagcgcaagactttgctctcatttcgcaaatcgcgacgctgaaaagccgc
gtgccatttattcatttctttgatggtttccgcacgtcccacgaaatcaataaaattgtc
ccgctggccgatgacacgattcttgatctcatgccgcaggtcgaaattgatgctcatcgc
gcccgggcactcaacccggaacatccggtgatccgcggtacgtccgccaatcctgacact
tatttccagtctcgcgaagccaccaacccatggtacaacgcggtctatgaccatgttgaa
caggcgatgaatgatttctctgccgcgacaggtcgtcagtatcagccgtttgaatattac
gggcatccgcaagcggaacgggtgattatcctgatgggctctgccattggcacctgtgaa
gaagtggttgatgaattgctaacccgtggcgaaaaagttggcgtgctgaaagttcgcctg
taccgccccttctccgctaaacatttactgcaagctctgccgggatccgtacgcagcgtg
gcggtactggacagaaccaaagaacccggtgcccaggcagaaccgctctatctggatgta
atgaccgcactggcagaagcctttaataatggcgagcgcgaaactctgccccgtgtcatt
ggtgggcgctatggtctttcatccaaagaatttggcccagactgtgtactggcggtattt
gccgagctcaacgcggctaaaccgaaagcgcgctttacggttggtatttacgatgatgtg
accaatctgtcactgccgttgccggaaaacaccctgccaaactcggcgaaactggaagcc
ttgttttatggccttggtagtgatggcagcgtttccgcgaccaaaaacaatatcaagatt
atcggtaattccacgccgtggtacgcacagggctattttgtttacgactccaaaaaggcg
ggcggcctgacggtttctcaccttcgagtgagcgaacagccgattcgttccgcttatctc
atttcccaggctgattttgttggctgccaccagttgcagtttatcgataaatatcagatg
gctgagcgtttaaaacctggcggcattttcctgctcaacacgccgtacagcgcagatgaa
gtgtggtcgcgcttgccgcaagaagttcaggccgtgttaaaccagaaaaaagcgcgcttc
tatgtgattaacgcggcgaaaatcgcccgcgaatgtggcctggcggcccgtattaatacc
gtcatgcagatggcttttttccatctgacgcaaattctgcctggcgatagcgccctcgca
gaattgcagggtgcgattgccaaaagttacagtagcaaaggccaggatctggtggaacgc
aactggcaggctctggcgctggcgcgtgaatccgtagaagaagttccgttgcaaccggta
aatccgcacagcgccaatcgaccgccagtggtttccgatgccgcccctgatttcgtgaaa
accgtaaccgctgcgatgctcgccgggcttggtgacgccctccccgtttcggcgctgccg
ccagacggcacctggccgatgggcactacgcgctgggaaaaacgcaatatcgccgaagag
atccccatctggaaagaggaactctgtacccaatgtaaccactgcgttgccgcttgccca
cactcagctattcgcgcaaaagtggtgccgcctgaagcgatggaaaacgcccctgccagc
ctgcattcgctggatgtgaaatcgcgtgatatgcgcgggcagaaatatgtcttgcaggtg
gcaccggaagattgcaccggttgtaacctgtgcgtcgaagtttgcccggcgaaagaccgt
cagaatccagagattaaagccatcaatatgatgtctcgcctggaacatgtcgaagaagag
aaaatcaattacgatttcttcctcaacctgccagaaatcgaccgtagcaaactggaacgt
attgatattcgtacatcgcagctgattacaccgctgtttgaatattcaggtgcttgctcc
ggttgtggcgagacgccgtatattaaattactgactcagctctatggcgaccggatgttg
atcgctaacgccactggctgttcttcaatttatggcggtaacctgccctctacaccgtat
accaccgatgccaacggtcgtgggccggcatgggcgaactctctatttgaagataatgcc
gaatttggccttggtttccgcctgacggtcgatcaacaccgtgtccgcgtgctgcgtctg
ctggatcaatttgccgataaaatcccggcggaattactgacggcgttgaaatcagacgcc
acgccagaggttcgtcgtgaacaggttgcagctttacgccagcaactcaacgatgttgcc
gaagcacatgaactgctacgtgatgcagatgcactggtggaaaaatcaatctggctgatt
ggtggtgatggctgggcttacgatatcggctttggcggtctggatcatgtattgagtttg
acggaaaacgtcaacattctggtgctggatacgcaatgctattccaacaccggtggtcag
gcgtcgaaagcgacaccgctgggtgcagtaactaaatttggcgagcacggcaaacgtaaa
gcgcgtaaagatcttggcgtcagtatgatgatgtacggtcatgtttatgtggcgcagatt
tctctcggcgcgcagctgaaccagacggtgaaagcgattcaggaagcggaagcgtatccg
gggccatcgctgatcattgcttatagcccgtgtgaagagcatggttacgatctggcactc
agccacgaccagatgcgccaactcacagctaccggcttctggccgctatatcgctttgat
ccgcgtcgtgccgatgaaggcaaactgccgctggccttggattcacgcccgccgtcagaa
gcaccggaagaaacgttacttcacgagcaacgtttccgtcggctgaattcgcagcagcca
gaagtggcagaacagttatggaaagatgctgcagctgatttgcaaaaacgctatgacttc
ctggcacaaatggccggaaaagcggaaaaaagcaacaccgattaa
              
                            

Download fasta file
RegulonDB