RegulonDB RegulonDB 10.9: Gene Sequence
feaR gene sequence


Size: 906        A: 232  T: 234  G: 234  C: 206

Fasta

 

>feaR E. coli K12. Version NC_000913.3 GI:556503834
atgaaccccgcagtggataatgagtttcagcaatggctttcccaaatcaatcaggtatgc
ggaaattttaccggacgcctgctgactgagcgttacacgggtgtactggacacgcatttt
gccaaaggactaaagctgagtaccgtgacaaccagcggggtgaatttatcccgcacctgg
caggaagtaaaaggcagcgacgatgcctggttttacaccgtttttcagcttagtggtcag
gcaataatggagcaggatgagcgtcaggtgcagattggcgctggcgatattacgttactc
gatgcctcacgcccctgttcgctttactggcaggagtcttctaaacagatttcattactt
ttgccacgcactctgctggaacaatattttccccatcaaaaacctatctgcgcagaaaga
ctggacgctgacttacccatggtgcaactcagtcatcgcctgttacaggagagcatgaat
aatccggcactttctgaaacagaaagtgaagctgcgctacaggcgatggtgtgtctgctg
cgcccggtacttcatcagcgggaatctgttcaacctcgtcgtgaacgtcagtttcaaaaa
gtggttacgttgatagacgataatattcgcgaagagatattacgcccggagtggatagcc
ggagagacaggtatgtcagtacgtagtttgtaccgaatgtttgccgataaaggtttggta
gtcgcgcaatatattcgtaaccgtcgtctcgatttttgtgcagatgcgattcgccatgcc
gcagatgatgaaaaactggcaggcatcggctttcattggggattttctgaccagagtcat
ttttcaacggtatttaagcaacgctttgggatgacgccaggcgagtatcgacgtaaattc
cgctaa
              
                            

Download fasta file
RegulonDB