RegulonDB RegulonDB 10.9: Gene Sequence
paaD gene sequence


Size: 498        A: 109  T: 111  G: 135  C: 143

Fasta

 

>paaD E. coli K12. Version NC_000913.3 GI:556503834
atgcaacgtctggccaccattgcaccgccacaggttcatgagatatgggcgctactcagc
cagatcccggacccggagatcccggtgctgaccattactgatttaggcatggtgcgtaat
gtgacacagatgggagaaggatgggtgatcggctttacgccgacatattccggttgtccg
gcaacggaacatttgattggcgcgatacgtgaggcaatgacaaccaacgggtttaccccc
gttcaggttgtgctgcaactcgacccggcatggaccaccgactggatgacccccgatgcc
cgtgagcgtctgcgagagtatggcattagcccgcccgccggacacagttgccatgcccat
ttgccgccagaagtacgttgcccgcgctgcgccagcgtccataccacacttatcagtgaa
tttggttccacggcctgcaaagcattgtaccgctgcgatagttgccgcgaacctttcgat
tatttcaaatgtatttga
              
                            

Download fasta file
RegulonDB