RegulonDB RegulonDB 10.9: Gene Sequence
paaE gene sequence


Size: 1071        A: 255  T: 245  G: 307  C: 264

Fasta

 

>paaE E. coli K12. Version NC_000913.3 GI:556503834
atgacaacgtttcattccttaacagtggcaaaagtcgagtcggaaacccgtgatgcggtg
accattacctttgcggtgccccagcctttgcaggaggcgtatcgctttcgccccggtcaa
catttgaccttaaaagccagctttgatggtgaagaattacgccgttgttactccatttgc
cgcagctatctgcctggcgaaattagtgtggcggtgaaagccattgaaggcggacgtttc
tcccgctatgcccgcgaacacatccgccagggtatgacgctggaggtcatggtgccgcag
gggcatttcggctatcagccgcaggccgaacgccaggggcgctatctggcaattgcagca
ggatcaggtattacgccaatgctggcgattatcgccaccactttacaaaccgagcctgaa
agtcagttcaccctgatctacggtaaccgtaccagccagagcatgatgtttcgccaggca
ctggcagacctgaaagacaaatatcctcagcgtttacagttgttgtgcattttcagtcag
gaaaccctcgacagcgatctgcttcacgggcgtattgacggtgaaaaattacagtcactt
ggggcctcgctcattaattttcgtctttatgatgaggcatttatttgtggtccggcggcg
atgatggatgacgcggaaaccgccttaaaagcactgggaatgccagataaaaccattcat
ctggagcggtttaatacgcctggcacgcgcgtcaaacgtagcgttaacgtgcaaagtgac
ggacaaaaagtgactgtacgtcaggatgggcgggatcgggaaatcgtgcttaatgccgac
gatgaaagcattctcgatgcggcattgcgccagggggcggatctgccctatgcctgcaaa
ggcggcgtctgtgcgacctgcaaatgcaaagtgctgcgtggcaaagtggcgatggaaacc
aattacagtctggaaccggatgaactggccgcaggttatgtgttgagttgccaggcactg
ccgctgaccagcgatgtggtggttgactttgacgcgaaggggatggcatga
              
                            

Download fasta file
RegulonDB