RegulonDB RegulonDB 11.0: Gene Sequence
paaY gene sequence


Size: 591        A: 151  T: 141  G: 179  C: 120

Fasta

 

>paaY E. coli K12. Version NC_000913.3 GI:556503834
atgccaatttatcagatagacggtctgactccggttgtgccagaagagagttttgtccat
ccgacagcggtattgatcggcgatgttattctcggcaagggcgtttacgttgggccaaat
gccagcctgcgtggcgattttggtcgtatcgtggtgaaagatggcgcgaacattcaggat
aattgcgttatgcacggttttcccgagcaggatactgttgtaggagaagatggacatatt
ggtcatagcgctatccttcacggctgcattatccgccgcaatgcattagtgggaatgaac
gcggtagtgatggacggtgcggtgattggcgagaacagcattgttggtgcatccgcattt
gtgaaagccaaagcagaaatgccagctaattacctgattgtcggcagcccggcgaaagcg
attcgtgaactcagtgagcaggagttggcatggaaaaagcagggtacgcatgagtaccag
gtgctggtgacacgctgtaagcagacgttacatcaagtcgagccattgcgggaaattgaa
cctggcaggaaacgcctggtatttgatgagaatctgcgaccgaaacagtaa
              
                            

Download fasta file
RegulonDB