RegulonDB RegulonDB 10.10: Gene Sequence
ydbA gene sequence


Size: 8622        A: 2423  T: 1928  G: 2276  C: 1995

Fasta

 

>ydbA E. coli K12. Version NC_000913.3 GI:556503834
atgcaaaggaaaactctattgtcggcctgtattgcattagctctgagtggtcagggttgg
gcggcagatatcacagaggtagaaaccaccacaggtgaaaagaaaaataccaatgtgact
tgtccggcagacccaggaaaactcagtccggaagagcttaaacgcttaccctctgaatgc
tctcctttagtcgaacaaaacctgatgccatggctttccacaggcgctgctgcgttaatc
acggccttagccgtagtggaactaaacgacgatgatgatcatcatcatcgcaacaattct
ccactcccaccgacaccccctgatgatgaatcagacgacactccagttcccccaactcct
ggcggagatgagataataccggacgatccggatgatacgcctacacctcccaaaccggtt
tcgtttaataatgacgttattctcgataaaacagaaaaaacgttaactattcgcgattca
gtttttacttataccgagaatgctgacgggactatatctctgcaagatagcaatggtcgt
aaggcaacgattaatctttggcagattgatgaagcgaataacactgttgcccttgaaggg
gtgagcgcagatggcgcaacgaagtggcaatataatcacaacggtgagcttgttattacg
ggtgataatgccacagtaaacaacaatggcaaaaccaccgttgacggtaaagattccacc
ggtacggaaatcaacggtaataacgggaaagtgattcaggacggcgatctggatgtcagc
ggcggcggtcacggtattgatatcaccggtgacagcgcgacggtggataacaagggcacc
atgaccgtcaccgatccggagtccatgggtatccagatcgacggtgacaaggccatcgtc
aataacgaaggcgagagcaccatcaccaacggtggcaccggcacccagattaatggtgat
gacgccacggcaaacaacaacggcaaaaccaccgttgacggcaaggattccaccggtacg
gaaatcaacggtaataacggaaaagttattcaggacggcgatctggatgtcagcggcggc
ggtcacggtattgatatcaccggcgacagcgcaacggtggataacaagggcaccatgacc
gtcaccgatccggagtccatcggtatccaggttgacggcgaccaggcggttgttaacaac
gaaggcgagagcgccatcaccaacggtggcaccggcacgcagattaacggtgatgacgcc
acggcaaacaacaacggcaaaaccaccgttgacggcaaggattccaccggtacggaaatt
gctggcaataacgggaaggtgattcaggacggcgatctggatgtcagcggcggcggtcac
ggtattgatatcaccggcgacagcgcaacggtggataacaagggcaccatgaccgtcacc
gatccggagtccatcggtatccagattgacggcgaccaggccatcgtcaataacgaaggc
gagagcactatcaccaatggcggcaccggcactcagatcaacggtaacgacgccaccgcg
aataacagtggaaaaaccactgttgatggaaaagattccacgggtaccaaaatcgcgggc
aatatcggcattgtaaatctggatggtagcctgactgttacaggcggtgcgcatggtgtt
gagaacattggtgacaacggcacggttaacaacaaaggagatattgttgtttccgatact
ggatcgattggcgtgctcatcaacggtgagggggcaacagtatccaatacgggtgatgtt
aacgttagcaatgaagcgacagggttcagcatcacaaccaacagtgggaaggtttcgctg
gcaggcagtatgcaggttggcgatttctcgaccggggtagatcttaatggcaacaataac
agcgtgacgctggcggcaaaagatctaaaagtggtcgggcagaaagcgacgggcataaac
gtttctggcgatgcgaatacagtgaatatcactggtaacgttctggttgataaggataaa
accgcagacaatgcggcggaatatttcttcgatccatccgtgggtatcaacgtttacggc
agtgataataacgtgacgctggatggaaagttaactgttgtatcagacagtgaggttact
tctcgtcagagtaatttatttgatggcagcgcagagaaaacgtcaggtctggttgtgatt
ggcgatggcaataccgttaatatgaatggtggacttgaactgattggagagaaaaacgcg
cttgcagatgggtcgcaggttacttccttgcgcacaggatatagttataccagcgttatt
gtcgttagtggtgagtcgtcggtatatctgaatggagatacgacaatcagcggagaattc
cctctggggtttgccggggttattcgggtacaggataaagctttgctggaaattggcagt
ggcgctacgctaacaatgcaggatattgacagttttgaacatcatgggacaagaacccca
gaacttacttatgctgattccggtgcgaaaattgttaataaaggtactgttgaaattcag
aatttaggttttgcttttgttactggtgaaaatacaacaggtataaatagtggcacgatc
tcgttattacaaaatggtaaagatccggcaccgtctcccattgttttactggctactaac
ggagggagcgccactaatgcaggtacgatcacaggtaaagtgacggaacaacatagcgta
tttaacaagtattcaacgggcacatcgaattcatttatttttaataacgatgtcagtagc
ataacagggttagtcgctcaatcgaatagcacaattatcaatactgacagcggcatcatt
gatttgtatggtcgtggtagtgtcggcatgcttgctatagcagattcaacagcagaaaat
cagggtaaaattacactggattctatgtgggtagatgcaaatgacactaccgcaatgcga
gatatagctagcaacagcgccattgacttcggtacaggtgtgggagttggtactgatagt
tatagtggtgcagggaaaaatgcaacagcaattaaccaattgggcggtgttataactatt
tataacgccggcgcaggtatggcggcctatggcgccagcaatacagttattaaccagggg
acgattaacctcgaaaaaaatggtaattatgacgatagtctggcagcaaatactctggta
gggatggctgtttatgagcatggtactgctatcaacgaccagacgggtgttatcaatatc
aatgttggtactggtcaggcgttttataacgatggcacaggaacaattgttaactatggt
acaatctgcactttcggcgtgtgccaatcggggaatgagtacaataatacagatgatttc
acctcactgatctataccggtggcgatacgattacacgaagcggagaaactgtaacgcta
aataaatctgctgctgtgactgataagctggctgggaatgttgttaatagcggaacgctt
tccggtgatcaaattacggtatcaagcggtcttctggaaaataccagcggtggcatcatc
aataacttagtaaaacttgacaagggtgccgtcattaaaaatgccggggtgatgacgaat
aacgtcgatgttagcggtggaatcctcaataatgccggagaaatgactgcgcaaattacc
atgaatgctggtgctgatagttcgttagtgaacaacaccggaaccatcaataaaatcgtg
cagaacgcgggggtattcaataatagtggcagtgtaacagggcggatgatgtcggctggc
ggggtctttaataatcaaactgacggggcgattatgagaggtgctgcgctgacaggtact
gcagtggcaaataacgaaggaacctggaacctcggaagtagtagtgagggtaacaacacc
gggatgctggaagttaataataattcagctttcaataaccgcggcgagtttattcttgat
aacgacaagaatgctgtgcacatcaaccagtccggtacgctttataataccggtcacatg
aacatcagtaattcttcccacaacggagccgttaatatgtggggcggaaatggtcgtttt
atcaatgacggaacgattgatgtttctgcgaagtcactggtagtcagcgctaataatgcc
ggcgatcagaatgccttcttctggaaccaggataacggggtcatcaacttcgatcacgac
agcgccagtgccgtgaaagtcacccacagcaactttattgcccagaatgacggcatcatg
aacatcagcggcaccggtgctgtggctatggaaggtgataagaacgcgcagctggttaac
aatggcaccatcaacctcggtaccgcaggcactactgacacgggtatgatcggtatgcaa
ctcgatgccaacgccacggcggatgcggtaatcgaaaacaacggcaccatcaatatcttc
gccaatgactcgtttgcatttagcgtactgggtacagtaggtcatgtggttaacaacggc
acggtggtgattgccgatggggttacgggttctggactgatcaagcagggcgacagcatc
aatgttgaaggtatgaacggtaacaacggtaatagcagcgaagtgcattatggcgactat
acgttgccggatgtgccgaagcccaatacggttagtgtaacgtcgggaagtgatgaggct
ggtggcagcatgaacaacctcaacggctatgtcgtcggtaccaacgttaacggcagcgcc
gggaagctgaaggttaacaatgccagcatgaacggcgtggagattaacacgggctttacc
gctggtacggcagacaccactgtgagttttgataacgtagtggaaggtagcaacctgacc
gacgctgacgccatcacctcaacgtccgtggtatggactgccaaaggcagcaccgatgcc
agcggtaacgttgacgtcaccatgagcaaaaatgcctacaccgatgtggcaacagatgcc
tcggtgaatgacatcgcgaaagcactggatgcgggttacaccaacaacgaactgtttacc
agcctgaacgtcggcacgactgctgaactgaacagtgctctgaaacaggtcagcggtagc
caggcgaccacggtattccgcgaagcgcgcgtgttaagcaaccgctttagtatgctggca
gatgccgcgccgaaagtgggtaacggtctggcgttcaacgttgtcgcgaaaggcgatccg
cgtgccgagttaggtaataataccgaatacgacatgctggcattgcgtaaaactatcgac
ctgagcgaaagccagacgatgagtctggagtacggtatcgctcgtctcgatggtgatggt
gcgcagaaagcgggtgataatggcgttacaggcggttatagccagttttttggcctgaaa
catcagatgtcgttcgataacggcatgaactggaataacgccttgcgttacgacgttcac
aaccttgacagcagccgctcgattgcatttggcaacacgaacaaaacggctgataccgac
gtgaaacagcagtacctggagttccgcagcgaaggggcgaagactttcgaaccgagcgaa
ggactgaaggttacgccatatgcgggtgtaaaactgcgtcacacactggaaggtggctat
caggagcgcaatgccggagactttaacctgaatatgaacagtggcagcgaaacggcggtg
gacagcatcgtcgggctgaaactggactacgcaggtaaagacggctggagcgctagcgct
acgctggaaggcgggccgaacctgagctacgcgaagagccagcgtacggcaagcctggca
ggcgcaggcagtcagcactttaacgtcgatgacggtcagaagggcggcggcatcaatagc
ctgacaagcgtcggcgtgaagtacagcagcaaagaaagttcgctgaatctggatgcgtac
aactggaaagaggatggcatcagcgataaaggcgtgatgctgaacttcaagaaaacgttc
taa
              
                            

Download fasta file
RegulonDB