RegulonDB RegulonDB 10.9: Gene Sequence
ynbC gene sequence


Size: 1758        A: 404  T: 459  G: 490  C: 405

Fasta

 

>ynbC E. coli K12. Version NC_000913.3 GI:556503834
atggaaaattcacgcatccctggggaacatttttttaccaccagtgataatacagcgttg
ttttatcggcactggcccgctttacagcccggggcgaaaaaggtcatcgtcttatttcat
cgcgggcatgaacattctggtcgtctacaacatctcgttgatgaactggcgatgccagat
actgctttttatgcctgggatgcccgagggcatggaaaaagttcggggccgcgtggttat
agcccatctcttgcgcgttcagtgcgggatgtcgatgaatttgtccgttttgctgccagc
gacagccaggttggactggaagaggtggtagtgatcgcgcaaagcgtcggcgcagtgctg
gttgccacatggattcatgattatgcacctgcaattcgcgggctggtgctggcttctccg
gcctttaaggttaaattgtatgtgccgctggcacgtcctgcgctggcgttatggcatcgt
ctgcgtggtctgttttttattaattcctatgtgaaaggacgctatttgacccacgatcgg
caacggggggcgagtttcaataatgatccgctgatcacacgggcgattgccgttaatatc
ttgctcgatctctacaaaacgtctgaacgtattattagagatgcggcggcgattacgctc
cccacgcaacttctgatatcaggcgatgactatgtggtgcatcgccaaccgcagattgat
ttttatcagagattacgtagccctctgaaagagctgcatctgctgccaggcttttatcac
gacacgttgggtgaagagaacagggcgctggcatttgaaaaaatgcaaagctttattagt
cgtttatatgctaacaaatcgcaaaaatttgattatcagcatgaagactgcacaggacca
tcagcggatcgatggcggctactttctggtggacccgtgccattatcgccggttgattta
gcgtatcgctttatgcgaaaggcgatgaaattgttcgggacgcactcttcgggcctgcat
ctcggaatgagcaccggctttgattcaggcagttcgctggattatgtctatcaaaatcaa
ccgcaaggtagtaacgcattcgggcgtttagtcgacaaaatctacctgaacagtgttggc
tggcgcggtattcgccagcgcaaaacccatttacaaatactgattaaacaagccgttgcc
gatctccacgccaaaggtttagccgtccgcgtggttgacattgccgcagggcatgggcgc
tatgtactggatgcgctggcaaacgagcctgccgtaagcgatattttgttacgtgattac
agcgagttaaatgttgcacaggggcaagagatgattgctcaacggggaatgtctgggcgg
gtgcgttttgaacagggcgatgcgtttaacccggaggaactcagcgcgttaactccgcgg
cctacgctggcgattgtctctggcctgtatgagctttttcccgaaaatgagcaggtaaaa
aactcactcgcaggtcttgccaatgccatcgaaccgggcggcattctcatctacaccggg
cagccgtggcaccctcaactggagatgattgccggggtgttaaccagtcataaagatggt
aaaccgtgggtaatgcgcgtgcgttcgcaaggggagatggattcactcgtgcgtgatgcc
ggatttgataaatgcacacaacggattgatgagtggggtatttttacggtttcgatggcg
gtgcgtcgtgataactga
              
                            

Download fasta file
RegulonDB