RegulonDB RegulonDB 10.9: Gene Sequence
ynbD gene sequence


Size: 1293        A: 262  T: 377  G: 363  C: 291

Fasta

 

>ynbD E. coli K12. Version NC_000913.3 GI:556503834
ttgctacaaggcgctggctggttattgttgctggccccgtttttcttcttcacctatgga
tctcttaatcagttcaccgcggttcaggaccttaacagccatgatatccccagtcaggta
ttcggttgggaaacggcgatcccttttcttccctggactattgttccttactggagtctg
gatcttttatatggattttcgctgttcgtttgtagcacgacattcgaacagcgccgactt
gtccaccggcttattctggcaacggtaatggcctgctgcggttttttgctctatccgctg
aagtttagttttatccgtcctgaagtgagtggggtgacgggatggctattttcgcaactt
gaactgtttgatctgccttataaccagtctccttcgctgcatattattctctgctggcta
ctttggcgtcactttcgtcagcatctggctgagaggtggcgtaaagtctgcggcggatgg
tttttactcatcgccatttcgacgctgacgacctggcagcatcattttattgatgtcatc
acagggctggcggtaggtatgttgattgactggatggtgcccgtcgaccgtcgttggaat
tatcagaaacctgatcaacgtcgaatcaaaatagcactgccctatgtcgtaggcgcgggc
tcgtgcattgtattgatggagctaatgatgatgattcagttatggtggtcagtctggtta
tgttggccagtattatcgctactcataattggccgtgggtacggtgggcttggcgcgata
acaacagggaaagatagtcaggggaaactaccgcccgccgtttactggctgacattgccc
tgccgcatcgggatgtggctgtctatgcgttggttttgtcgtcgcctggagccggtgagc
aaaatgactgctggtgtttatttaggggcgtttccacgacatattccggcacagaatgcg
gttctggacgtcacctttgaattccctcgcggacgagccacaaaagatcgactctatttt
tgtgtaccgatgctggatctggtggttccggaagagggggagctccgacaggccgtggcg
atgctggaaacattacgcgaagagcaaggcagcgttctggtccattgtgcattgggatta
tcgcgcagtgcgctggtggtggcggcatggttgttatgttacggacactgtaaaaccgtt
aatgaagcgattagctatattcgagccagacgcccgcagattgtgctgacagacgagcac
aaagcgatgctgagattatgggaaaacaggtaa
              
                            

Download fasta file
RegulonDB