RegulonDB RegulonDB 10.9: Gene Sequence
ydcI gene sequence


Size: 924        A: 217  T: 240  G: 242  C: 225

Fasta

 

>ydcI E. coli K12. Version NC_000913.3 GI:556503834
atggaaaaaaatagtctgtttagtcagcgcatccgtttgcgccaccttcatacattcgta
gctgtcgcacaacaaggaactttggggcgcgcggctgaaacccttaatttgagtcaacct
gcgctctctaagacattgaatgaactggagcagctgactggcgctcgcttgtttgagcgt
ggtcgtcagggggcgcaacttaccttacccggcgaacaatttttaacgcatgcagtcaga
gttcttgacgccatcaacactgccggacggtcgcttcatcgtaaagaaggtcttaataat
gatgtcgtcagggttggtgcactacctactgcggcactggggatattaccttcggttata
ggtcagtttcatcagcaacaaaaagagacgaccttgcaagttgcgacaatgagtaaccct
atgattctggcgggtttaaaaaccggggaaatcgatatcggcattggtcggatgtcagat
cctgaactgatgaccgggcttaattacgaactgctgtttcttgaatcgttgaagctggtt
gtccgccctaatcacccgctacttcaggagaacgtaacgctaagccgggtgctggaatgg
ccggtcgttgtatcaccagaaggcactgcgccacgccagcattcagatgcattagtgcag
agccagggctgtaaaattccttcgggttgtatcgaaacgctgtctgcttcgctatctcgt
caacttacggttgaatacgattacgtgtggtttgtcccttctggcgctgtaaaagacgac
ctgcgtcatgccacgctggtggccctgcctgttccgggacatggtgcaggcgaaccgatt
ggaatactgacccgcgtagatgcgacgttctcttctggttgccagttgatgattaacgct
attcgaaaatcaatgccgttctga
              
                            

Download fasta file
RegulonDB