RegulonDB RegulonDB 10.9: Gene Sequence
ydcJ gene sequence


Size: 1344        A: 321  T: 315  G: 383  C: 325

Fasta

 

>ydcJ E. coli K12. Version NC_000913.3 GI:556503834
atggcgaacagcatcacggcggatgagattcgggaacagttttcgcaggcaatgtcagcc
atgtaccagcaagaagttccgcaatatggcacgctgctggaactggtagctgatgtgaat
ctggctgtgctggaaaacaatcctcaactgcacgaaaaaatggtaaatgcagacgagctg
gcgcgactgaatgttgaacgtcatggggcgattcgcgttgggactgcacaagagcttgct
actcttcggcggatgtttgccattatggggatgtacccggtgagctattacgatctctcg
caggcaggggtgccggtacattcgacagcatttcggcccattgatgatgcttctctggcg
cgtaatcccttccgcgtttttacctccttactccgccttgagcttatcgagaacgaaatt
ttgcgccagaaagcggcggagattctgcgtcagcgcgatatcttcaccccacgttgtcga
caactgttagaggaatatgagcagcagggcggttttaacgaaacacaggcacaggagttt
gtgcaggaagccctggaaacgtttcgctggcaccagtcagcaacggtagatgaagaaacc
tatcgcgcattgcacaacgaacatcggttgattgctgatgtggtctgttttcctggatgc
catatcaaccacctgacgccacgtacgctggatattgaccgggtgcagtcgatgatgcct
gaatgcggaattgaacccaaaattctcatcgaggggccgccgcgccgcgaggtaccgatt
ttactacgccagaccagctttaaagcactggaagagacggtgttgtttgcggggcagaaa
cagggcacgcataccgcgcgctttggtgaaattgagcagcgtggcgtggcattaacgccg
aaagggcgacaactgtatgatgatcttctgcgtaacgctggaaccgggcaggataatctc
actcaccaaatgcatttacaggaaaccttccgcacttttcctgacagtgagtttttaatg
cgtcagcaagggttggcatggttccggtaccgtctgacgccttcgggtgaggcgcatcgt
caggcgattcatcctggagacgatccacagcccttaattgaacgtggttgggtagtggcg
caacccatcacctatgaagatttcttgcccgttagcgcggcggggatcttccagtcaaat
ctgggtaatgaaacgcagacacgcagtcacggtaatgccagtcgcgaagcatttgagcag
gcgttgggttgtccggttttggatgagttccagctttaccaggaagcggaagaacgcagt
aaacgtcgctgtggtttgctttaa
              
                            

Download fasta file
RegulonDB