RegulonDB RegulonDB 10.9: Gene Sequence
ydcK gene sequence


Size: 981        A: 260  T: 246  G: 269  C: 206

Fasta

 

>ydcK E. coli K12. Version NC_000913.3 GI:556503834
atgcgcaaatatcgtctaagtgaagaacagcgagcctttagttatcaggaagatggcact
aaaaaaaatgtgttattacggcagattatcgccattagcgattttaacgatgtgatagca
ggaaccgctggcggctggatcgatcgcgaaacggtgttagcacaagaaggaaattgctgg
atttacgaccagaatgctattgcgttcggcggagcggtgatttccggtaatacgcgtatc
accggcaccagcgtgctgtggggagaggtttacgcaacggataacgtctggatcgataat
agtgaaatcagccagggtgcatatataagtgacagcgtcaccattcatgactcattagtt
tacgggcaatgtagaatatttggtcacgccttaattgatcaacattctatgatcgtcgcc
gcacaaggcttaacgcccgaccatcaactcctgctccaaatttatgatcgcgcaagggtt
agcgcctcgcgtattgtccaccaggcacaaatttatggcgatgccgtcgtccggtatgct
tttattgaacatcgcgccgaagtttttgattttgccagtattgaaggtaatgaagagaac
aatgtctggctatgcgattgcgctaaagtctacggtcacgcgcaggtgaaagctggcata
gaagaagatgccattccgacgattcattacagttcgcaggtggcggaatatgccattgtg
gaaggtaattgtgtgttaaaacatcatgtcttggttggcggaaatgccgtggtacgtggc
ggaccgattctgctcgacgagcacgttgtcatacaaggtgagagccgtattacaggtgcg
gtgataattgaaaaccatgtggagttaaccgaccacgccgtcgttgaagcctttgatggc
gacacggttcatgtccgtggtccaaaagtcattaacggcgaggagcgcattacgcgaacg
ccgctggcagggttattgtga
              
                            

Download fasta file
RegulonDB