RegulonDB RegulonDB 10.9: Gene Sequence
ydcL gene sequence


Size: 669        A: 199  T: 171  G: 156  C: 143

Fasta

 

>ydcL E. coli K12. Version NC_000913.3 GI:556503834
atgcgtaccacatcatttgcgaaagttgcagctttatgcggcttattggctctgtctggt
tgtgcatctaaaatcacccagccagataaatattctggttttttaaacaattactctgat
ttaaaagaaacaacctcggctacaggtaaacctgttttacgttgggtagacccgagtttt
gatcaaagcaaatatgacagcatcgtctggaacccaatcacttattatccggtaccgaaa
ccgtcgacccaggtagggcagaaagttctggataaaattttgaactataccaacaccgaa
atgaaagaagcgatagcgcagcgtaaaccactggttaccaccgctgggccgcgtagtctg
attttccgtggggccattaccggtgtagataccagcaaagaagggctgcaattctatgaa
gtggttcctgttgcattagtggttgcggggacgcaaatggctacaggccaccgtaccatg
gatactcgcctctattttgaaggtgagctgattgatgcagcgactaataaaccggttatc
aaagtcgttcgtcagggcgaaggtaaagacctgaataacgaaagtacgccaatggctttc
gaaaatattaaacaagttattgatgacatggcgaccgatgccaccatgtttgacgttaac
aaaaagtag
              
                            

Download fasta file
RegulonDB