RegulonDB RegulonDB 10.9: Gene Sequence
insQ gene sequence


Size: 1149        A: 313  T: 240  G: 311  C: 285

Fasta

 

>insQ E. coli K12. Version NC_000913.3 GI:556503834
atgaggcgcttcgcaggcgcatgtcgtttcgttttcaatcgtgctctggcacgtcagaat
gagaatcatgaggccggtaataaatacatcccttacgggaaaatggcttcctggctggtt
gagtggaaaaatgccactgaaacgcaatggcttaaagattctccctcacagccattgcaa
cagtcactgaaagaccttgagcgggcttacaaaaacttcttccggaagcgggctgctttt
ccccgattcaaaaagcggggacagaatgatgcattccgctacccgcagggcgttaagctc
gatcaggaaaacagccgtatttttctgccgaaactgggctggatgcgctaccggaacagc
cgtcaggtcacgggtgttgtgaaaaatgtcactgtcagccagtcctgcggtaagtggtac
atcagtattcagacagaaagtgaagtatcaactccggttcacccttcagcatcaatggtc
gggctggatgctggcgtggctaaactcgccacgctgtcagatggcacagtctttgagcct
gtaaacagttttcagaaaaaccagaagaagctggcgagacttcagcgacagttaagccgc
aaggtcaaattcagcaacaactggcaaaagcagaaacgcaaaatacagcgactgcattcc
tgtatcgcaaatatccgcagggactaccttcacaaagtcacaacggccgtcagcaaaaac
cacgcaatgatagtcattgaggatttgaaggtcagcaacatgtcaaagtcagcagcgggt
acggtcagccagccggggcgcaatgtccgggcaaaatcaggtttaaaccgttcgatactg
gatcagggctggtatgaaatgcgccgccagcttgcgtataagcagctctggcgtggcggt
caggtgcttgctgttccgccagcgtatacaagccagcgttgcgcgtactgtggtcataca
gcgaaagagaaccgcctgtcacaaagtaaattcagatgccaggtatgtggatatacagcg
aacgccgatgtaaatggcgctcgcaacattttagcggcggggcacgccgttcttgcctgt
ggagagatggtgcagtcaggccgcccgttgaagcaggaacccaccgaaatgattcaggcg
acagcctga
              
                            

Download fasta file
RegulonDB