RegulonDB RegulonDB 10.8: Gene Sequence
sutR gene sequence


Size: 537        A: 131  T: 141  G: 131  C: 134

Fasta

 

>sutR E. coli K12. Version NC_000913.3 GI:556503834
atggaaaatctcgctcgctttttatccaccacacttaaacaactacgccagcagcgcggc
tggagtctttcgcgactggcagaagcgacgggcgtttctaaagcaatgttagggcagatt
gagcgtaatgagtccagtccgacggtcgcgacattatggaaaattgccaccgggttgaac
gtaccattttcaacatttatttctccgccgcagtccgctacgccttcagtttatgatcca
caacagcaggcgatggtgatcacttcgctgtttccttatgatccacaactctgctttgaa
cacttctcgattcagatggcatctggtgcaataagcgaatcgacgccccatgagaagggg
gtaatcgaacatgtcgtcgtcattgatggacaacttgatctgtgcgttgatggggaatgg
cagacccttaattgtggggaaggcgttcgatttgctgcagacgtcacgcatatctatcgt
aatggtggggagcaaaccgtacattttcattccctcatccattacccgcgcagttaa
              
                            

Download fasta file
RegulonDB