RegulonDB RegulonDB 10.8: Gene Sequence
rlhA gene sequence


Size: 1962        A: 499  T: 461  G: 524  C: 478

Fasta

 

>rlhA E. coli K12. Version NC_000913.3 GI:556503834
gtgaccgtatcttctcatcgacttgaactgttaagcccggcacgcgatgccgccattgcc
cgcgaagctattttgcacggtgccgatgctgtttatatcggcggccctggttttggtgcc
cgtcataatgccagtaatagcttgaaagatattgccgagctggtgccgtttgcccatcgt
tatggtgcaaaaattttcgtcacgcttaacaccattttgcatgatgatgagctggaaccc
gcgcaacggctgattactgacctctaccagaccggtgtcgatgcgctgattgttcaggat
atggggattctggaacttgatattccgccgattgaactgcacgccagtacgcagtgcgac
attcgtacagttgaaaaagcgaagttcctctctgatgttggcttcacgcagattgtgctg
gcgcgagagctgaatcttgatcagatccgcgcgattcaccaggctacggacgcgaccatt
gaattctttattcatggggcactgtgcgtggcctattcgggtcagtgctacatttctcat
gcgcaaacagggcgtagcgccaaccgtggcgattgctcgcaggcgtgccgtttgccatac
acattgaaagacgatcaggggcgggtggtttcctatgaaaaacatctgctgtcgatgaaa
gataacgatcagactgccaacctcggcgcgctgattgatgctggtgtacgctccttcaag
attgaagggcgttacaaagatatgagctacgtgaagaatatcaccgcccattatcgccag
atgcttgatgccattattgaagaacgtggcgatctggcgcgcgcttcatcaggtcgtact
gaacatttctttgttccatcgacggaaaagactttccaccgtggtagcacagattatttt
gtgaatgcccgtaaaggcgatattggcgcgttcgattcgccgaaatttatcggcctgccg
gtaggcgaagtagtgaaagtggcgaaagatcatctcgatgttgccgttaccgagccactg
gcaaatggcgatggcctgaacgtgttgattaaacgtgaagtcgtcggttttcgtgccaat
acggtcgagaaaaccggagaaaatcagtaccgcgtctggcccaatgaaatgccagcagat
ttgcacaaaattcgtccacatcacccactaaaccgtaatcttgatcataactggcagcag
gcactgacaaaaacctccagcgaacgtcgggtggcggtagacattgaactgggcggctgg
caggaacaactgattctgaccctcaccagtgaagagggtgtcagcatcacgcatacgctg
gacgggcagttcgacgaagccaataacgccgaaaaagcaatgaacaatctgaaggatggt
ctggcaaaactggggcaaaccctctattacgcccgcgatgtgcaaattaatttgccgggg
gcgctgtttgtaccaaacagtctgttaaaccagttccgccgtgaagctgctgacatgctg
gatgctgcgcgtcttgccagttaccagcgcggcagccgtaaaccggttgctgatcctgcg
ccggtttatccgcaaacgcatctgagtttcctcgcgaacgtatacaaccagaaagcgcgt
gaattttatcatcgctatggtgtgcagctgattgacgcggcgtatgaagcacatgaagag
aagggcgaagtcccggtgatgatcaccaagcattgtctgcgctttgcctttaatctgtgc
ccgaaacaggcgaaaggcaatatcaaaagctggaaggcgacgccaatgcaactggttaac
ggcgatgaagtattaacgctaaagtttgattgccgcccatgcgagatgcacgtcattggc
aaaatcaaaaatcacatactgaaaatgccgttaccgggaagcgtagtggcatccgtaagt
ccggatgagctgctgaaaacattgccgaagcgaaaagggtaa
              
                            

Download fasta file
RegulonDB