RegulonDB RegulonDB 10.9: Gene Sequence
null gene sequence


Size: 198        A: 44  T: 56  G: 43  C: 55

Fasta

 

>null E. coli K12. Version NC_000913.3 GI:556503834
ttgtttcaggattgctttacgcaatggttctttaatctcatcgcaggggtgacgcggcat
gacactgcgcctcccatgaaacctgagtttcaaatggttgctgccattcgctacatcgac
gccctgagattcgagccaacgtctgaactcgctttgtttcacatcgcctccctgccgctg
agtatatcaacaaagtaa
              
                            

Download fasta file
RegulonDB