RegulonDB RegulonDB 10.9: Gene Sequence
ydcR gene sequence


Size: 1407        A: 338  T: 346  G: 376  C: 347

Fasta

 

>ydcR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaaaataccagcagcttgcagaacaattacgcgagcagattgcgtcgggtatctgg
caacccggcgatcgtttgccttcgttgcgtgaccaggtggcgctttcaggcatgagcttt
atgactgtcagccatgcctatcagttgctcgaaagtcagggatatattatcgcacgaccg
cagtcgggttattacgttgcgccacaggcaataaaaatgccgaaagcgccagtcattcca
gtcactcgagatgaagcagtcgatatcaacacttatatttttgatatgttgcaggccagt
cgcgatccgtcggtcgttccgtttgcctcggcctttcccgacccgcgacttttccccctc
caacaactaaaccgctcgctggcgcaggtaagcaaaaccgccacagcgatgagcgtgatt
gaaaacttaccgccaggaaacgcagaactgcgtcaggctattgctcgtcgctatgcctta
cagggcatcaccatttctcctgatgaaattgtcattactgccggggcgttagaggcatta
aacctcagtttgcaagcggtaactgaaccgggcgattgggtgatagtagagaatccttgt
ttctacggtgcgttgcaggcgctggagcggctacggctgaaggcgttatcggtggcgacg
gatgttaaagaagggatagatcttcaggcgctggaactggcgttgcaggagtatccggtg
aaagcgtgctggctgatgactaatagccagaatccactcggatttaccttaacgccgcaa
aaaaaagcacaactggtggcgttgctcaatcagtacaacgtaacgctgattgaagatgac
gtttacagcgaactttattttggacgggaaaaaccgctgcctgcgaaagcgtgggatcgc
cacgatggcgttttgcattgctcttcgttttcgaaatgtctggtgcctggttttcgtatt
ggttgggtcgccgccggaaaacatgcacgtaaaattcaacgcttgcagttgatgagtacg
ctttccaccagctcaccgatgcaacttgcgctggtggattacctttccacgcgccgatac
gacgcccatcttcgtcgcctgcgtcgccagcttgcggaacgtaaacaacgtgcctggcag
gcactgctgcgttatctgcctgcggaagtgaaaattcatcataatgacagtggttacttt
ctctggttggagctccccgagccgttagatgccggcgaattaagcctggcggcactgacg
catcatatcagtattgcgccgggtaaaatgttttctaccggtgaaaactggtcacgtttt
ttccgttttaataccgcgtggcagtggggagagcgtgaagaacaggcggtaaaacaatta
ggcaaacttattcaagaacggctgtaa
              
                            

Download fasta file
RegulonDB