RegulonDB RegulonDB 10.9: Gene Sequence
ydcS gene sequence


Size: 1146        A: 293  T: 248  G: 318  C: 287

Fasta

 

>ydcS E. coli K12. Version NC_000913.3 GI:556503834
atgagcaagacatttgcccgcagcagcctgtgtgcgctcagcatgacaataatgaccgct
cacgccgccgaaccgcctaccaatttagataaaccggaagggcgactggatattatcgcc
tggccgggatacatcgaacgcggacaaactgataaacaatacgactgggtaacgcagttc
gaaaaagagacaggctgcgcggtgaatgtgaaaaccgccgcgacttccgatgaaatggtc
agtctgatgaccaaagggggttacgatctggttacggcatccggcgatgcctcgctgcgt
ttgattatgggtaaacgcgtgcagccgattaataccgcattgattcccaactggaaaacg
ctcgatccgcgcgtggttaaaggcgactggtttaatgttggcggcaaagtttacggcaca
ccttaccaatgggggccgaacctgctgatgtacaacactaaaaccttcccgacgccgccg
gatagctggcaagtggtttttgttgagcaaaatctgccggacggcaagagcaataaaggc
cgcgttcaggcttatgatggccctatctatattgcggacgctgcgttgttcgttaaagcc
actcagccgcagttgggcatcagcgatccgtatcaactcaccgaagaacagtaccaggcg
gtgctgaaagtgctgcgcgctcaacacagtttgatccatcgctactggcatgacactacc
gtgcaaatgagcgatttcaaaaacgagggtgtggttgcttccagtgcctggccctatcag
gccaacgccctgaaagccgaaggccagcctgttgctaccgttttcccgaaggagggtgtt
accggttgggctgataccaccatgctgcatagcgaagcgaaacatccggtttgcgcctac
aaatggatgaactggtcattaacgccaaaagtgcagggcgatgtggcggcctggtttggc
tcgttaccggtagtgccggaagggtgtaaagccagtccgttattaggcgaaaaaggttgt
gaaaccaacggttttaactatttcgacaaaatcgccttctggaaaacgcctatagcagaa
gggggcaagtttgttccctacagtcgctggacgcaggattacattgccattatgggcggt
cgctaa
              
                            

Download fasta file
RegulonDB