RegulonDB RegulonDB 10.9: Gene Sequence
ydcT gene sequence


Size: 1014        A: 222  T: 240  G: 303  C: 249

Fasta

 

>ydcT E. coli K12. Version NC_000913.3 GI:556503834
atgacgtacgcagtggagtttgacaacgtctcgcggttgtacggtgacgtgcgcgcagta
gatggcgtcagtattgcgataaaagatggtgagttcttctctatgctggggccgtccggc
tccggcaaaaccacctgcctgcgcctgattgctggcttcgaacagctttccggcggggct
atctctatctttggtaaacccgccagcaatctgccaccgtgggagcgggacgtgaatact
gtctttcaggactacgcgctatttccgcatatgtcgattcttgacaatgtcgcctatggg
ctgatggtcaaaggcgtgaataaaaagcagcggcacgcaatggcgcaagaggcgctggag
aaagtggcgttggggtttgtacatcaacgtaaaccgtcacaactttctggtggtcagcgc
cagcgggttgctatcgccagagcattggtgaatgaaccgcgcgtattgctgttggatgaa
ccgctcggcgcactggatctcaaattgcgtgagcagatgcagctggaactgaaaaaactg
caacagtctctcggtatcacttttatcttcgttacccacgatcagggcgaagcgttatcg
atgtccgatcgtgtggcggttttcaataatggacgcattgagcaggtcgattccccgcgc
gatctctatatgcgcccgcgcacgccgtttgttgccgggttcgttggtacatcgaatgtt
tttgatggactgatggcagagaaactttgtggcatgacgggaagcttcgccctgcgaccg
gaacatatccgcctcaacacccctggtgaactgcaggccaatggcacgatccaggcggtg
caatatcagggcgcggcaactcgttttgaactgaaattgaacggcggtgaaaaactgctt
gtgagtcaggccaatatgacaggcgaagaactgcctgccacgctcacgcccggacaacag
gtgatggtttcctggtcgcgtgatgtgatggtgccgctggttgaggagaggtga
              
                            

Download fasta file
RegulonDB