RegulonDB RegulonDB 11.0: Gene Sequence
ydcU gene sequence


Size: 942        A: 162  T: 281  G: 262  C: 237

Fasta

 

>ydcU E. coli K12. Version NC_000913.3 GI:556503834
atggcgatgaatgtattgcaatcaccttcacgtccaggtctgggtaaggtgtccggtttc
ttctggcataatccggggctggggctgtttttactgctgcttggcccgctaatgtggttt
ggcattgtctatttcggctcgctgctgacactgttatggcagggattttatacttttgac
gatttcaccatgtcggtaacgccggaactgacgctggcgaatatccgtgcgctgtttaat
ccggcgaattacgacatcattctccgcacgctgactatggctgtggcagtcactatcgcc
agcgccattctggcttttccaatggcgtggtatatggcgcgctataccagcgggaaaatg
aaagcgtttttttatattgcggtaatgttgccgatgtgggcgagctacattgttaaagcc
tatgcctggacgttattgctggcaaaagatggcgtggctcagtggtttttacaacatctt
gggctggaaccactgctgactgcgttccttacattacctgcggtgggcggaaatacgctg
tcaacttccgggctggggcgctttctggtgtttctctatatctggttgccgttcatgatc
ctgcccgttcaggcggcgcttgagcgtttgccgccgtcattgttgcaggcgtcggctgat
ctcggcgcacgtccacgacaaacctttcgctatgtggtgctgccgctggcaatcccgggt
attgccgctggctctatctttaccttctcactcacactgggcgattttatcgtcccgcag
ctggttggtcctccaggatattttatcggcaatatggtttattcccagcagggggcgatt
ggcaatatgccgatggcggcggcattcaccctggtgccgattattctcatcgcactgtac
ctggcgttcgtgaaacgtctgggagcgttcgatgcactctga
              
                            

Download fasta file
RegulonDB