RegulonDB RegulonDB 11.0: Gene Sequence
ydcV gene sequence


Size: 795        A: 145  T: 221  G: 227  C: 202

Fasta

 

>ydcV E. coli K12. Version NC_000913.3 GI:556503834
atgcactctgaacgcgcaccgtttttcctcaaactggcggcctggggcggcgttgttttc
ctacattttcccatcctgataatcgccgcctatgcgtttaacactgaagatgcggcgttt
agttttccaccgcagggcctgacgctgcgctggtttagcgtggcagcacagcgtagtgat
attcttgatgccgtgacactgtcacttaaagtggcggcgctggcgacattaattgcgctg
gtgttagggacgctggcagctgccgcgctgtggcgacgagactttttcggcaaaaacgcc
atttcgctgttactgctgctgcccattgcgctgccgggcattgtcactggtctggcgtta
ttaaccgcctttaaaaccatcaatctggagccgggatttttcaccatcgtggtcggtcat
gcgactttttgtgtagttgtggtgtttaacaatgtcatcgcccgttttcgccgcacctcc
tggagtctggttgaggcgtcaatggatcttggggccaatggctggcaaaccttccgctac
gtagtgttgccgaatctcagttcggcgttactggcaggaggaatgctggcgtttgccttg
tcgttcgatgaaatcatcgttacgacctttacggcaggtcatgaacgaacgttaccgttg
tggttgctcaatcagcttgggcgaccgcgtgatgtaccggtaactaacgtggtggcactg
ctggttatgttggtaacaaccttgccgatcctgggggcctggtggctaacccgcgaaggc
gacaatggtcaataa
              
                            

Download fasta file
RegulonDB