RegulonDB RegulonDB 10.10: Gene Sequence
patD gene sequence


Size: 1425        A: 339  T: 328  G: 440  C: 318

Fasta

 

>patD E. coli K12. Version NC_000913.3 GI:556503834
atgcaacataagttactgattaacggagaactggttagcggcgaaggggaaaaacagcct
gtctataatccggcaacgggggacgttttactggaaattgccgaggcatccgcagagcag
gtcgatgctgctgtgcgcgcggcagatgcagcatttgccgaatgggggcaaaccacgccg
aaagtgcgtgcggaatgtctgctgaaactggctgatgttatcgaagaaaatggtcaggtt
tttgccgaactggagtcccgtaattgtggcaaaccgctgcatagtgcgttcaatgatgaa
atcccggcgattgtcgatgtttttcgctttttcgcgggtgcggcgcgctgtctgaatggt
ctggcggcaggtgaatatcttgaaggtcatacttcgatgatccgtcgcgatccgttgggg
gtcgtggcttctatcgcaccgtggaattatccgctgatgatggccgcgtggaaacttgct
ccggcgctggcggcagggaactgcgtagtgcttaaaccatcagaaattaccccgctgacc
gcgttgaagttggcagagctggcgaaagatatcttcccggcaggcgtgattaacatactg
tttggcagaggcaaaacggtgggtgatccgctgaccggtcatcccaaagtgcggatggtg
tcgctgacgggctctatcgccaccggcgagcacatcatcagccataccgcgtcgtccatt
aagcgtactcatatggaacttggtggcaaagcgccagtgattgtttttgatgatgcggat
attgaagcagtggtcgaaggtgtacgtacatttggctattacaatgctggacaggattgt
actgcggcttgtcggatctacgcgcaaaaaggcatttacgatacgctggtggaaaaactg
ggtgctgcggtggcaacgttaaaatctggtgcgccagatgacgagtctacggagcttgga
cctttaagctcgctggcgcatctcgaacgcgtcggcaaggcagtagaagaggcgaaagcg
acagggcacatcaaagtgatcactggcggtgaaaagcgcaagggtaatggctattactat
gcgccgacgctgctggctggcgcattacaggacgatgccatcgtgcaaaaagaggtattt
ggtccagtagtgagtgttacgcccttcgacaacgaagaacaggtggtgaactgggcgaat
gacagccagtacggacttgcatcttcggtatggacgaaagatgtgggcagggcgcatcgc
gtcagcgcacggctgcaatatggttgtacctgggtcaatacccatttcatgctggtaagt
gaaatgccgcacggtgggcagaaactttctggttacggcaaggatatgtcactttatggg
ctggaggattacaccgtcgtccgccacgtcatggttaaacattaa
              
                            

Download fasta file
RegulonDB