RegulonDB RegulonDB 10.9: Gene Sequence
ortT gene sequence


Size: 174        A: 32  T: 64  G: 38  C: 40

Fasta

 

>ortT E. coli K12. Version NC_000913.3 GI:556503834
atgtctctctatcaacacatgcttgttttttatgcggttatggcagcaatcgcatttctt
atcacctggtttctttctcacgataagaaacgcatccgtttcttaagcgcctttctggtg
ggggcaacatggccgatgagtttcccggtggcgctgttgttttcactgttttaa
              
                            

Download fasta file
RegulonDB