RegulonDB RegulonDB 10.9: Gene Sequence
ydcY gene sequence


Size: 234        A: 66  T: 41  G: 64  C: 63

Fasta

 

>ydcY E. coli K12. Version NC_000913.3 GI:556503834
atgtcgcatctggatgaagtcatcgcgcgcgtggatgccgcgattgaagagagcgtcatt
gcccatatgaacgaattattaatcgccctgagcgatgacgcggagttaagtcgggaagat
cgctacacccagcagcaacgtctgcgcacagcgatcgcccatcacggtcgcaagcataaa
gaagatatggaagcgcgccacgaacagttaaccaaaggcggcaccatcctctga
              
                            

Download fasta file
RegulonDB