RegulonDB RegulonDB 10.9: Gene Sequence
ydcZ gene sequence


Size: 450        A: 77  T: 140  G: 126  C: 107

Fasta

 

>ydcZ E. coli K12. Version NC_000913.3 GI:556503834
atgaatcagtcgctcacccttgcttttttgattgccgccggaattggtctggttgtccag
aacacgctgatggtgcgcatcacccagacctcctctaccattctcatcgccatgttgctg
aactcactggtggggattgtgctctttgtttctattttatggtttaaacaaggcatggcg
gggtttggcgaactggtgtccagcgtgcgctggtggacacttatacctggcttgctggga
tcgttttttgtcttcgccagtatcagcggatatcagaatgtgggagcggcgacaactatt
gctgtactggtcgccagtcagctgattggcggtctgatgctggatatcttccgcagtcat
ggcgtaccactacgggcgttgttcggcccaatttgtggcgcaattttacttgtggttggc
gcctggttggtagccagacgctcattttaa
              
                            

Download fasta file
RegulonDB