RegulonDB RegulonDB 10.9: Gene Sequence
mnaT gene sequence


Size: 519        A: 114  T: 129  G: 155  C: 121

Fasta

 

>mnaT E. coli K12. Version NC_000913.3 GI:556503834
atgtccatccgttttgcccgcaaagccgactgtgctgccattgcggaaatttataaccac
gccgtgttgtatacggcggctatctggaatgaccaaacggtggatgctgataaccgcatt
gcctggtttgaagcgcggactttagcaggttatccagtgctggtgagcgaggaaaacggc
gtagtgacgggatatgcctcgtttggcgactggcgtagtttcgatggttttcgccatacc
gtggaacattcggtttatgtccatcccgatcatcagggcaaaggtctggggcgtaaattg
ttaagccgattgattgatgaagcgcgggattgcgggaagcatgtcatggtcgccgggatc
gaatcgcaaaatcaggcctcgctgcatctccaccagtcgctgggatttgtcgtcaccgcg
caaatgccgcaggtaggcactaaatttggtcgttggctggatctgacatttatgcagttg
caactcgacgagcgcactgaaccggacgcgattggatga
              
                            

Download fasta file
RegulonDB