RegulonDB RegulonDB 10.9: Gene Sequence
curA gene sequence


Size: 1038        A: 243  T: 252  G: 321  C: 222

Fasta

 

>curA E. coli K12. Version NC_000913.3 GI:556503834
atggggcaacaaaagcagcgtaatcgacgttgggttctggcctcgcgtccacatggcgca
cctgttccggagaatttccgtcttgaagaagatgatgtcgccacaccgggtgaaggacag
gtgttactgcgcacagtttatttgtccctggacccgtatatgcgtggacgtatgagcgat
gagccatcttattcaccgcctgttgatattggcggcgtgatggtcggcggtacggtgagc
cgtgtcgtggagtcgaatcatcctgattatcagtctggcgactgggtgctgggctacagt
ggatggcaagactatgacatatccagtggtgatgatctggtgaaacttggcgatcatccg
caaaatccatcgtggtcgctgggtgtgctagggatgccaggctttaccgcttatatgggc
ctactggatatcggtcagcctaaagagggcgaaacgttggtggtagctgcggcgacagga
ccagtgggggcgacggtggggcaaatcggcaaacttaaaggttgcagagtggtgggggta
gccggtggcgcggaaaaatgccgccatgctaccgaggtgttaggcttcgatgtttgtctt
gatcaccacgcggatgattttgccgaacaactggcgaaagcgtgcccaaaaggtattgat
atctattatgaaaacgtgggcggtaaggtattcgatgcggtgctaccgttacttaataca
tctgcgcgcattcccgtctgcggattagtgagcagctataacgctacagagctaccaccc
ggtccggatcgtttacctctgttgatggctacagtgctgaaaaaacgtattcgcttgcaa
ggttttattatcgctcaggattatggtcaccgcatccatgagtttcagagggagatgggg
caatgggtgaaagaggataaaatccactaccgcgaagaaattactgacggtttagagaat
gcgccacagacgtttatcggcctgctgaagggtaaaaacttcggcaaagtggtgatccgc
gtggcgggtgatgattaa
              
                            

Download fasta file
RegulonDB