RegulonDB RegulonDB 10.8: Gene Sequence
mcbR gene sequence


Size: 666        A: 206  T: 169  G: 156  C: 135

Fasta

 

>mcbR E. coli K12. Version NC_000913.3 GI:556503834
atgcctggaacgggaaaaatgaaacatgtcagtttgactctgcaggttgagaacgacctg
aaacatcagcttagtattggcgcattaaaacctggcgcacgcctgattactaaaaatctg
gcggagcaattaggtatgagtattacacctgtgcgtgaagcattattacgtctggtttcg
gtgaatgcgctttctgtcgcacctgcacaagcatttacagttccggaagtggggaaacgt
caattagacgaaatcaatcggatccgctacgaactggaattaatggcagttgctctggct
gttgaaaacctcaccccgcaagaccttgcggaactccaggaattgctcgagaaattacag
caggcgcaagaaaagggcgacatggaacaaatcattaatgtaaacaggctatttcgctta
gcgatttatcatcgctcaaatatgcccatcctgtgtgagatgattgagcaactgtgggtc
aggatggggcctggtttacattatctctatgaagcgattaatccagcggaattacgggag
catatagaaaactatcatctgttactcgctgcgttaaaagcaaaagacaaagagggatgc
agacattgtcttgctgaaattatgcaacaaaatattgctattttataccagcaatacaat
cgttaa
              
                            

Download fasta file
RegulonDB