RegulonDB RegulonDB 10.9: Gene Sequence
yncD gene sequence


Size: 2103        A: 547  T: 482  G: 571  C: 503

Fasta

 

>yncD E. coli K12. Version NC_000913.3 GI:556503834
atgaagattttttccgtccgacagaccgttttgcccgcactgcttgtcctttcccccgtt
gtttttgccgctgatgaacagactatgattgtcagtgccgcaccgcaggtggtttcagaa
ctggataccccagcagcagtaagcgtggtggatggcgaggagatgcgcctggcaacaccg
cgcattaacttgtccgaatcactgaccggcgtgcctggtttgcaggtacaaaaccggcag
aactatgcgcaagatttacagctgtcgattcgcggatttggctcccgctccacttacggt
attcgcggtattcgcctgtatgtggacggtattcccgccaccatgcccgacgggcaaggg
caaacatccaacatcgatttaagcagtgtgcaaaatgtggaagtgctgcgtggccccttc
tctgccctgtatggcaacgcgtctggtggggtaatgaatgtcaccacccagaccggacaa
cagccaccaaccattgaagccagtagttactacggcagttttggcagctggcgctatggg
ctgaaagcaacgggcgcaacgggagacggcacacagcctggcgatgtcgattacaccgtc
tcaaccacgcgttttacgacccacggctatcgtgaccatagtggcgcacagaaaaattta
gccaatgccaaactgggcgtacgcattgatgaagccagcaaattaagtctgattttcaat
agtgtggatatcaaagcagatgacccaggtgggctaaccaaagcagaatggaaggctaat
ccacaacaagcgcctcgtgcagaacagtacgacacgcgaaaaaccatcaagcaaactcag
gctgggttgcgctatgagcgtagcctgagttcgcgggatgatatgagtgtgatgatgtat
gccggagagcgagaaacgacccagtaccagtcaatacccatggcaccacaacttaacccg
tcacatgcgggcggcgtgattaccctgcaacgccattaccagggaatagacagccgctgg
acacaccgtggtgaactgggcgttccggtcacgttcactaccggcctgaactacgaaaac
atgagtgaaaaccgcaagggctacaataacttccgcctgaatagcggcatgccggagtac
gggcaaaaaggtgagttgcgtcgcgacgaacgcaatctgatgtggaacatcgatccctat
ttacagacgcagtggcagctgagcgaaaaactgtcgctggatgctggcgtgcgctacagc
tccgtgtggtttgattccaacgaccattacgttactccgggtaacggcgatgacagcggt
gatgccagttatcataaatggctacctgccggttcgttaaaatatgcaatgaccgatgcc
tggaatatctatctggcagccgggcgaggttttgaaacgccgacgattaatgagctgtct
tatcgtgctgatgggcaaagcggtatgaacttaggtttaaaaccatccaccaacgataca
attgagatcggcagtaaaacgcgtattggtgatgggctgcttagtctcgcattgtttcag
accgacactgatgatgaaattgttgtcgatagcagtagcggtgggcgtacgacttacaaa
aatgccggaaagacccgtcgtcaaggcgctgaactggcatgggatcaacgtttcgcagga
gattttcgcgtaaacgcgtcctggacctggcttgatgcgacctatcgcagcaatgtttgc
aatgaacaggattgtaacggtaatcggatgccagggatcgcccgtaatatgggctttgcg
tcgataggttatgtaccggaagatggttggtatgcaggcacggaagcgcgttatatgggc
gatattatggcagatgatgaaaatacggcaaaagcgccgtcttatactctcgtcggctta
ttcaccgggtataaatacaattaccacaatttaactgtggatttatttggtcgtgtcgat
aatttattcgataaagaatacgttggttctgtcattgtcaatgagtcaaacgggcgatat
tacgaaccttcgcccggacgaaattatggtgtcggcatgaatattgcgtggagatttgag
taa
              
                            

Download fasta file
RegulonDB