RegulonDB RegulonDB 10.9: Gene Sequence
yncE gene sequence


Size: 1062        A: 288  T: 236  G: 283  C: 255

Fasta

 

>yncE E. coli K12. Version NC_000913.3 GI:556503834
atgcatttacgtcatctgttttcatcgcgcctgcgtggttcattactgttaggttcattg
cttgttgtttcatcattcagtacgcaggccgcagaagaaatgctgcgtaaagcggtaggt
aaaggtgcctacgaaatggcttatagccagcaagaaaacgcgctgtggctcgccacttcg
caaagccgcaaactggataaaggtggcgtggtttatcgtcttgatccggtcactctggaa
gtgacgcaggcgatccataacgatctcaagccgtttggtgccaccatcaataacacgact
cagacgttgtggtttggtaacaccgtaaacagcgcggtcacggcgatagatgccaaaacg
ggcgaagtgaaaggccgtctggtgctggatgatcgtaagcgcacggaagaggtgcgcccg
ctgcaaccgcgtgagctggtagctgacgatgccacgaacaccgtttacatcagtggtatt
ggtaaagagagcgtgatttgggtcgttgatggcgggaatatcaaactgaaaaccgccatc
cagaacaccggtaaaatgagtaccggtctggcgctggatagcgaaggcaaacgtctttac
accactaacgctgacggcgaattgattaccatcgacaccgccgacaataaaatcctcagc
cgtaaaaagctgctggatgacggcaaagagcacttctttatcaacattagccttgatacc
gccaggcagcgtgcatttatcaccgattctaaagccgcagaagtgttagtggtcgatacc
cgtaatggcaatattctggcgaaggttgcggcaccggaatcactggctgtgctgtttaac
cccgcgcgtaatgaagcctacgtaacgcatcgtcaggcaggtaaagtcagtgtgattgac
gcgaaaagctataaagtggtgaaaacgttcgatacgccgactcatccaaacagcctggcg
ctgtctgccgatggcaaaacgctgtatgtcagtgtgaaacaaaaatccactaaacagcag
gaagctacccagccagacgatgtgattcgtattgcgctgtaa
              
                            

Download fasta file
RegulonDB