RegulonDB RegulonDB 10.9: Gene Sequence
ansP gene sequence


Size: 1500        A: 285  T: 435  G: 439  C: 341

Fasta

 

>ansP E. coli K12. Version NC_000913.3 GI:556503834
atgagtaaacacgacaccgacacttcagatcaacacgccgcgaaacgccgctggcttaat
gcccacgaagaggggtatcacaaagcgatgggcaatcgccaggtgcagatgatcgccatt
ggcggcgcgattggcaccggcttgtttttaggtgcaggagcccgactgcaaatggcgggg
cccgcactggcactggtttatttaatttgtggcttgttttcgttttttattctgcgtgca
ttgggtgagctggtgctacaccgcccttccagtggcagttttgtttcttatgcccgtgag
tttttgggtgagaaagccgcttatgttgctggctggatgtacttcatcaactgggcgatg
acggggattgttgatattaccgccgtcgctctgtatatgcattactggggtgcgtttggc
ggcgtgccgcagtgggtctttgcgctcgctgcacttaccatcgttggcaccatgaatatg
atcggtgtgaaatggtttgcggagatggagttctggtttgcgcttattaaagtgctcgcc
attgtgacctttttggtcgtgggtacagtgttcctcggtagtggtcagccgctggatggc
aacaccactggctttcatttaatcaccgataatggcggcttcttcccccacggtttgctg
cctgcgctggtgttgattcagggcgtagtgtttgcttttgcctccattgaaatggtgggt
acagctgccggagaatgtaaagatccgcagaccatggtgcctaaagccattaacagtgtg
atttggcgtattggcctgttttacgtcggctccgtggtgttgctggttatgttattgccg
tggagcgcgtatcaggcggggcaaagtccgttcgtgacgtttttctctaaactgggtgtg
ccatatatcggcagcattatgaacattgtggtgctgaccgctgccctctccagcctgaat
tcaggtctgtactgcaccggacgtattctgcgctcaatggcgatgggcggttccgcaccg
agttttatggcgaaaatgagtcgtcagcatgtgccgtatgccgggattctggcgacacta
gttgtgtatgtcgtcggcgtattcctcaactatctggtgccgtcgcgcgtatttgagatt
gtgttgaacttcgcgtcgctgggaatcatcgcttcatgggcgtttatcatcgtgtgccag
atgcgcctgcgtaaagcgattaaagaaggcaaagcagcggatgtcagttttaaactgcct
ggcgcgcccttcacttcctggctgacattactgtttttactgagtgtccttgtgctgatg
gcgttcgattacccgaacgggacttatactatcgcggcgctgccgattatcggtattttg
ctggttataggctggtttggtgtgcgcaaacgcgttgctgaaattcacagcactgcgcca
gtcgtcgaggaagatgaagaaaaacaggaaattgtgtttaagcctgaaacggcgagttaa
              
                            

Download fasta file
RegulonDB