RegulonDB RegulonDB 10.9: Gene Sequence
yncG gene sequence


Size: 618        A: 151  T: 174  G: 163  C: 130

Fasta

 

>yncG E. coli K12. Version NC_000913.3 GI:556503834
atgattaaggtgtatggcgtacccggatggggctctacaatcagtgagctgatgctaaca
ctggctgatattccttatcagttcgttgatgtcagtggttttgaccacgagggagcttca
cgcgagttattgaaaaccctgaacccgttgtgtcaggttccgacactggcattggaaaat
gacgagattatgacggagacagcggcgattgcattgatggttctcgatcgtcgcccggac
cttgcgccaccggttgggcgcgccgaacgtcagctgtttcaacggctattggtctggctg
gttgctaatgtctatccaacattcactttcgccgattaccctgagcgttgggctcctgac
gcacctgaacagttaaagaagaatgttattgaatatcgaaaatcgctttatatctggttg
aattcgcagctcactgctgaaccttatgcgtttggtgagcaactaacgctggtggactgt
tatctttgcactatgcgcacatgggggcctgggcatgaatggtttcaggataatgccacg
aatatcagtgcgattgctgatgctgtatgtcagttaccgaaattacaagaagtattaaaa
aggaatgaaattatttga
              
                            

Download fasta file
RegulonDB