RegulonDB RegulonDB 10.9: Gene Sequence
yncH gene sequence


Size: 213        A: 66  T: 80  G: 33  C: 34

Fasta

 

>yncH E. coli K12. Version NC_000913.3 GI:556503834
atggtatgttttttaatttatatcactctccttttcattcagcgtgtctatttcatttcc
tctgaaaagaaactaactattcacatcgtgcagatgtttcagttgttatcacaggcattc
tataatctcaaaatgtttttaatgatggatatgctcggagttggagatgcaattaatatt
aatacaaataaaaatatccggcaggtatgctaa
              
                            

Download fasta file
RegulonDB