RegulonDB RegulonDB 10.9: Gene Sequence
yncI gene sequence


Size: 1054        A: 370  T: 285  G: 252  C: 147

Fasta

 

>yncI E. coli K12. Version NC_000913.3 GI:556503834
gtgagtattcaaagtttgcttgattatatttcagtgacccctgatatacgacaacaagga
aaggttaaacataaattatctgctattttgtttctcaccgtatgtgcagtaattgcaggt
gccgatgagtggcaggaaattgaagattttggacatgaaagacttgaatggctaaagaaa
tatggtgattttgataatggcattccggtcgatgacaccattgcacgcgttgtgagtaac
attgacagtttggcctttgaaaagatgtttattgaatggatgcaggagtgccatgaaatc
actgatggtgaaattatagcaatagatggaaagaccataagaggctcctttgataaggga
aaaagaaaaggagcaatccatatggtgagtgcattctcgaacgaaaatggtgttgtactg
gggcaggtgaaaacggaagccaaaagtaatgagattacagccattccagagttgcttaac
ctactgtatttaaagaaaaatttgataaccattgatgctatgggctgtcagaaagatatc
gcttcgaagatcaaagataaaaaagcagattatcttctggcagtaaaaggcaatcagggg
aaattacatcatgcattcgaggaaaaatttcctgtaaatgtgttttctaattataaaggc
gattcgtttagtacgcaggagataagtcatggaagaaaagaaacacgtttgcatattgtc
agtaacgtaacgcctgaacttttgtgattttgaattcgaatggaagggattaaaaaagct
ttgtgtagcattgtcattcaggcagaagaaagaagataaatcagcagaaggtgtaagcat
ccgatattatatttcatcaaaggatatggatgctaaagaatttgcacatgctatcagagc
gcactggctgatcgagcacagtcttcattgggtgttagatgtaaaaatgaatgaagatgc
cagccggataagaagaggaaacgcagcctaaataatatctggaataaagaagatggcact
gaatttattaagagattgcaaagacattaagggt
              
                            

Download fasta file
RegulonDB