RegulonDB RegulonDB 10.9: Gene Sequence
yddH gene sequence


Size: 570        A: 133  T: 145  G: 173  C: 119

Fasta

 

>yddH E. coli K12. Version NC_000913.3 GI:556503834
atgagccgattcatccccatagaattacaccatgccagccgtctgttaaatcatggccca
acggtcttgatcaccagtttcgatgagcaatcccagcggcgtaacattatggctgcagcc
tggtcaatgccggtggagtttgaacctccacgcgtggcgattgtggtagataaatcgaca
tggaccagggagttgattgaacataacggtaaatttggcatcgttatcccgggcgttgca
gcaactaactggacgtgggcggtgggaagtgtgtcggggcgtgatgaagataaatttaat
tgctatggcattccggttgtgagaggcccggtatttggtttgcctctggtcgaggaaaaa
tgtctggcgtggatggagtgtcgattgctacctgcgacttctgcgcaagaagaatacgac
acgctgtttggcgaagtagtatcagcagcggcagacgcacgggtatttgtcgaaggccgc
tggcagtttgatgatgataagctcaatacgttgcatcatttaggtgctgggacgtttgtt
accagcggcaagcgtgttacggcgggttaa
              
                            

Download fasta file
RegulonDB