RegulonDB RegulonDB 10.10: Gene Sequence
nhoA gene sequence


Size: 846        A: 187  T: 224  G: 249  C: 186

Fasta

 

>nhoA E. coli K12. Version NC_000913.3 GI:556503834
atgacgcccattctgaatcactattttgcccgtattaactggtcgggagctgctgcggtc
aatattgatacgcttcgtgcattgcacctgaaacacaattgcaccattccgtttgaaaac
ctcgacgttttgctgccgagggaaatacagcttgataatcaatcgccggaagagaaactg
gtgatagcccgtcgtggcggttactgttttgagcagaatggcgtgtttgagcgggtgtta
cgcgagctggggtttaacgttcgcagcttgttagggcgcgtagtgttatcaaatccgcca
gcattaccgccgcgcacccatcgtttgctgttggtggaactggaagaggaaaaatggatt
gctgatgtcggtttcggtgggcagacgctaaccgcgccgattcgtttagtttccgatctc
gtgcagaccacgccacacggagagtatcggttgttgcaggagggtgatgattgggtgttg
cagtttaatcatcatcagcattggcagtcgatgtaccgttttgatctctgcgagcagcaa
caaagcgattatgtgatgggcaatttctggtcggcgcactggccgcagtcgcattttcgc
catcatttgctgatgtgccgccatttgccggacggcggcaagctgacactgaccaatttt
cattttacccattatgaaaatgggcacgcggtggagcagcgaaatctaccggatgtggcg
tcattatatgctgtgatgcaagaacagtttggtctgggcgtggatgatgcgaaacatggc
tttaccgtggatgagttagcgctggtgatggcggcgtttgatacgcacccggaggcggga
aaataa
              
                            

Download fasta file
RegulonDB