RegulonDB RegulonDB 10.9: Gene Sequence
yddJ gene sequence


Size: 336        A: 115  T: 101  G: 56  C: 64

Fasta

 

>yddJ E. coli K12. Version NC_000913.3 GI:556503834
atgcagctcatgttatttaatttgttttccccagcacttaagcttaatactggcctggca
attctttcgcctggtgcatttgaagttcactctgacggaatagatgtggataacgaattg
tttcactatcctattaaaaaagcatataccccatataatatacacacttacaagacagag
gaagttgtaaaccagatgaatataaaagttaaaaacatgaccttagatgaaataaacaat
acttactgtaataacgattattacaatcaggcaataagagaggaaccgatagaccttctg
gacagatcgttttcctccagttcatggcctttttag
              
                            

Download fasta file
RegulonDB