RegulonDB RegulonDB 10.8: Gene Sequence
yddK gene sequence


Size: 957        A: 365  T: 284  G: 118  C: 190

Fasta

 

>yddK E. coli K12. Version NC_000913.3 GI:556503834
atgatcactgaccttatattacacaatcatcccaggatgaaaacaatcactttaaacgac
aaccatattgcacatttaaacgccaaaaacactacaaaactggaatatttaaacttaagc
aataacaatttactgccaaccaatgacattgatcaactaatatcatcaaaacatctttgg
catgtattagttaacggcatcaacaatgatccacttgcacaaatgcagtactggactgca
gtaagaaatataattgatgacactaatgaagtgaccattgatttatcaggacttaattta
accactcaaccaccagggctgcaaaacttcacatctatcaatcttgataataaccaattc
acacattttgatgcaaccaactacgatagactcgtaaagctaagtctgaatagtaatgct
cttgagtcaataaattttcctcaaggcagaaatgtaagtattacacatatatctatgaat
aataatgctctcagaaatattgatatagataggctttcatcagttacttattttagtgcg
gcacataatcaactagagtttgtgcaattagaatcttgcgaatggctgcaatacctgaat
ctcagccataatcaattaactgatattgttgcaggtaataaaaatgaactcttactgctg
gatctatcccataataaactaacaagtttacacaatgacttatttcccaacttgaatacg
ttacttattaacaacaatttgctttctgaaattaaaatattctatagcaacttctgcaat
gttcagacattaaacgctgctaacaaccagttgaaatatataaatcttgatttcctgact
tatcttccatctatcaaaagtttaagactggacaataataaaataacccacattgatact
aataatacatccgatattggaactttattccccataataaaacagagcaaaacttaa
              
                            

Download fasta file
RegulonDB