RegulonDB RegulonDB 10.9: Gene Sequence
ddpA gene sequence


Size: 1551        A: 436  T: 334  G: 387  C: 394

Fasta

 

>ddpA E. coli K12. Version NC_000913.3 GI:556503834
atgaagagatcgatatcgtttcgtcccacattgctcgcgctcgtccttgccacaaatttc
ccggttgcgcacgccgccgtaccaaaagatatgctggtgattggtaaggccgccgatcca
caaaccctcgacccggcggtaacaatagataataacgactggacagtgacctacccgtct
tatcagcggctggttcagtacaaaacggacggtgataaaggctcaaccgacgttgaaggc
gatctggcaagtagctggaaagcgtctgacgatcaaaaagagtggacgttcaccctgaaa
gataatgctaaatttgccgatggcacacctgtcactgccgaagcagtaaaactttctttt
gagcggctactaaaaatcggccaggggccagcagaagcatttcccaaagatttaaagatt
gatgctcccgacgaacatacggtgaagtttacccttagccaaccattcgcaccgttcctc
tacacgctggcgaatgacggtgcatccattatcaatccggcggtcttaaaggaacatgca
gcggatgatgctcgcggcttcctcgcgcaaaataccgccggttccggaccatttatgctg
aaaagctggcaaaaaggtcagcaattagttctggtgccaaatccgcattacccaggcaat
aaaccgaacttcaaacgggtatcggtaaaaattattggtgaaagtgcctcccgtcgcctg
cagctctcccgtggcgacattgacattgccgatgcgctgccggtggatcaactcaacgcc
ctgaagcaggaaaataaagtcaatgtggcagagtatccgtcactgcgcgttacctatctg
tatctgaataacagcaaagcgcctcttaatcaggcggatctgcgtcgggccatttcctgg
tctaccgattatcagggcatggttaacggcattctgagtggtaacggaaaacagatgcgc
ggcccgattccggaaggcatgtggggctacgatgcgacggcaatgcaatacaaccatgac
gaaacgaaagccaaagccgaatgggataaagtgacgagcaaacccaccagcctgacgttt
ctctactccgataacgatccgaactgggagcctattgctctggcgacacaatccagtctc
aacaagctgggcatcattgtgaagctggaaaagctggcgaacgccaccatgcgcgacaga
gtgggtaaaggtgattacgacattgcgattggcaactggagtccggattttgccgacccg
tatatgtttatgaattactggtttgagtcagacaaaaaaggtctgccgggtaaccgctcg
ttctatgaaaacagtgaggtcgataagttactgcgcaatgcgcttgcgaccaccgaccag
acgcagcgtacccgggactaccagcaggcacagaaaatcgtcattgatgacgctgcttat
gtgtacctgttccagaaaaactaccaactggcgatgaacaaagaggtgaaaggctttgtg
ttcaatcccatgctggaacaggtcttcaatatcaataccatgagtaaataa
              
                            

Download fasta file
RegulonDB