RegulonDB RegulonDB 10.10: Gene Sequence
ydeM gene sequence


Size: 1158        A: 361  T: 349  G: 230  C: 218

Fasta

 

>ydeM E. coli K12. Version NC_000913.3 GI:556503834
atgcacgttacagccaagccctccagttttcaatgtaatctcaaatgtgattactgtttt
taccttgaaaaagagtcgcagtttactcatgaaaaatggatggatgacagcactctgaaa
gagttcatcaaacaatatatcgcagcgtctggcaatcaggtctattttacctggcaaggc
ggtgaacccactctggctggcctggattttttccgtaaagttattcactatcaacaacgc
tatgcaggccaaaaacgtatttttaatgcattacaaacgaatggcattttattgaataat
gaatggtgtgcctttctcaaagaacatgaatttctggttggtatctcgatcgatggcccc
caggagttacatgaccgttacagacgcagtaattcaggtaacggtacttttgcaaaagtg
atagcagccatcgagcgtctgaaatcatatcaagtagagtttaatacgttaaccgtcatt
aataacgttaatgtccattaccctcttgaggtttatcattttttaaaatctatcggcagt
aaacatatgcaatttatcgaattgctagaaaccgggacgccgaatattgatttcagtggt
catagtgagaacacattccgtatcattgatttttctgtgcctcccacggcttatggcaag
tttatgtcaaccatttttatgcaatgggttaaaaacgatgtgggtgaaattttcatccgt
cagtttgaaagctttgtcagccgttttttggggaatgggcataccagttgtattttccag
gagtcctgcaaggataatctggttgttgaaagtaatggagacatttacgaatgcgaccat
tttgtctatccacagtacaaaattggaaacattaataaatctgaactcaaaacgatgaac
agtgtacaactgacagcgcaaaaaaaacggattccagcgaaatgtcagcaatgtgcatat
aaacctatctgcaatggcggttgtcctaagcatcgtattactaaagtaaacaatgagact
gtttcttatttttgcgaaggttataaaatccttttttcaaccatggtaccttatatgaac
gccatggtagagttagctaagaacagagtaccgctttaccacattatggatgttgcaaaa
caaatggagaataattaa
              
                            

Download fasta file
RegulonDB