RegulonDB RegulonDB 10.9: Gene Sequence
ydeN gene sequence


Size: 1683        A: 517  T: 424  G: 352  C: 390

Fasta

 

>ydeN E. coli K12. Version NC_000913.3 GI:556503834
atgaagtctgcattaaagaaaagtgtcgtaagtacctcgatatctttgatactggcatct
ggtatggctgcatttgctgctcatgcggcagatgatgtaaagctgaaagcaaccaaaaca
aacgttgctttctcagactttacgccgacagaatacagtaccaaaggaaagccaaatatt
atcgtactgaccatggatgatcttggttatggacaacttccttttgataagggatctttt
gacccaaaaacaatggaaaatcgtgaagttgtcgatacctacaaaatagggatagataaa
gccattgaagctgcacaaaaatcaacgccgacgctcctttcattaatggatgaaggcgta
cgttttactaacggctatgtggcacacggtgtttccggcccctcccgcgccgcaataatg
accggtcgagctcccgcccgctttggtgtctattccaataccgatgctcaggatggtatt
ccgctaacagaaactttcttgcctgaattattccagaatcatggttattacactgcagca
gtaggtaaatggcacttgtcaaaaatcagtaatgtgccggtaccggaagataaacaaacg
cgtgactatcatgacaacttcaccacattttctgcggaagaatggcaacctcaaaaccgt
ggctttgattactttatgggattccacgctgcaggaacggcatattacaactccccttca
ctgttcaaaaatcgtgaacgtgtccccgcaaaaggttatatcagcgatcagttaaccgat
gaggcaattggcgttgttgatcgtgccaaaacacttgaccagccttttatgctttacctg
gcttataatgctccgcacctgccaaatgataatcctgcaccggatcaatatcagaagcaa
tttaataccggtagtcaaacagcagataactactacgcttccgtttattctgttgatcag
ggtgtaaaacgcattctcgaacaactgaagaaaaacggacagtatgacaatacaattatt
ctctttacctccgataatggtgcggttatcgatggtcctctgccgctgaacggggcgcaa
aaaggctataagagtcagacctatcctggcggtactcacaccccaatgtttatgtggtgg
aaaggaaaacttcaacccggtaattatgacaagctgatttccgcaatggatttctacccg
acagctcttgatgcagccgatatcagcattccaaaagaccttaagctggatggcgtttcc
ttgctgccctggttgcaagataagaaacaaggcgagccacataaaaatctgacctggata
acctcttattctcactggtttgacgaggaaaatattccattctgggataattaccacaaa
tttgttcgccatcagtcagacgattacccgcataaccccaacactgaggacttaagccaa
ttctcttatacggtgagaaataacgattattcgcttgtctatacagtagaaaacaatcag
ttaggtctctacaaactgacggatctacagcaaaaagataaccttgccgccgccaatccg
caggtcgttaaagagatgcaaggcgtggtaagagagtttatcgacagcagccagccaccg
cttagcgaggtaaatcaggagaagtttaacaatatcaagaaagcactaagcgaagcgaaa
taa
              
                            

Download fasta file
RegulonDB