RegulonDB RegulonDB 10.9: Gene Sequence
safA gene sequence


Size: 198        A: 66  T: 58  G: 38  C: 36

Fasta

 

>safA E. coli K12. Version NC_000913.3 GI:556503834
atgcatgcgaccacagtgaaaaacaaaatcacgcaaagagacaactataaagaaatcatg
tctgcaattgtggttgtcttattactgacacttacgttgatagccattttttcggcaatt
gatcagctgagtatttcagaaatgggtcgcattgcaagagatcttacacatttcattatc
aatagtttgcaaggctga
              
                            

Download fasta file
RegulonDB