RegulonDB RegulonDB 10.9: Gene Sequence
ydeP gene sequence


Size: 2280        A: 585  T: 548  G: 606  C: 541

Fasta

 

>ydeP E. coli K12. Version NC_000913.3 GI:556503834
atgaagaaaaaaattgaatcctaccagggtgctgcaggtggttggggtgctgttaaatcc
gtagcgaatgcagtacgtaagcagatggatatacgccaggatgttattgccatgtttgac
atgaataagccagagggctttgactgtccgggttgtgcatggccagatcctaagcacagt
gcgtcattcgacatttgtgaaaacggcgcaaaagcaatcgcctgggaagtcacggataag
caggtaaacgcctctttctttgctgagaatacggttcaatcattacttacctggggagac
cacgagcttgaggctgcggggcgactcactcagcctttgaaatatgatgccgtcagcgac
tgttacaagccattaagctggcaacaagctttcgacgaaattggcgcacgccttcaaagc
tatagtgatcccaatcaggttgaattctatacttcgggccgcacttccaatgaagctgcc
tttctttatcagctttttgcccgtgaatacgggagcaataactttcccgactgctccaac
atgtgccatgaaccgacaagcgtgggtttggcagcgagtatcggtgtaggtaaagggacc
gtgttgctggaagactttgagaagtgcgatttagtcatttgcattgggcataaccctggt
acaaaccaccctcgcatgctgacttcgttgcgcgctttagtgaaacggggagcgaaaatg
atcgccatcaatcctctacaggaacgtggcctggagcgatttaccgcaccgcaaaacccg
tttgaaatgctgacgaactctgagactcagttggccagtgcctactataacgtgcgcatt
ggtggcgatatggcgttgctcaaggggatgatgcgcctgttaattgagcgcgatgatgct
gcaagcgccgcaggtcggccttcattgcttgatgacgagtttattcaaacgcataccgtc
ggctttgacgagctacgccgtgacgttctcaattccgagtggaaagatatcgaacgtatt
tctggactaagtcagacacaaatcgccgaactggctgacgcatatgccgctgccgaacgc
accattatctgttacggaatggggatcactcagcacgaacatggtacccagaacgtacag
caactggtcaatctgctgttgatgaaaggtaacattggcaagcctggtgcgggtatctgc
ccactacgtggacactctaatgtacagggcgaccgaaccgtcggtatcaccgagaaaccg
tctgcagagtttctggctcgtctgggtgagcgctatggcttcaccccacctcatgcacct
ggacatgctgcaattgccagcatgcaagcaatatgtacggggcaggctcgagcattgatc
tgcatggggggcaattttgcgctggcaatgccagatcgggaagcgagcgctgtaccgtta
acgcaattagatttggcggtacacgtagccactaagcttaaccgctctcatctgttgacc
gcacggcatagctatattctgccggtcctgggacgtagcgagattgacatgcaaaaaaac
ggtgcgcaggcggtaaccgttgaggattcaatgtcgatgattcatgcctcgcgtggcgtg
ttaaaacccgccggtgtaatgctgaaatcagagtgtgcagtggtcgcgggaatcgcgcag
gcagcactaccccagagcgtggtagcctgggagtatctggtggaagattatgatcgcatt
cgcaatgacattgaagctgtgctgccagagttcgccgactataaccagcgcatccgtcat
cccggtggttttcacctgataaatgcagctgctgaaaggcgctggatgacgccgtcaggt
aaggctaatttcattaccagcaaagggctgttagaagatccctcttcagcgtttaacagt
aagctggtcatggcgacagtacgcagccacgatcagtacaacacgacgatttatggtatg
gatgatcgctatcgaggggtattcggtcaacgagatgtggtctttatgagtgctaaacaa
gctaaaatttgccgtgtaaaaaacggcgaaagagttaatcttattgcgcttacgccagac
ggtaagcgcagctcacgccgcatggatagattaaaagtggtcatttaccctatggctgac
cgctcactggtgacctattttccagaatcgaatcacatgctaacacttgataaccacgat
ccattaagtggcattcctggctataaaagtattccggttgaattagaaccatcaaattaa
              
                            

Download fasta file
RegulonDB