RegulonDB RegulonDB 10.8: Gene Sequence
ydeR gene sequence


Size: 504        A: 154  T: 124  G: 117  C: 109

Fasta

 

>ydeR E. coli K12. Version NC_000913.3 GI:556503834
atgaaaagacttcacaagaggttcctgttagctacgttttgcgcgttattcacagcaact
ctccaggccgccgatgtcactatcactgttaatggtcgggtagtcgctaaaccctgcact
attcaaaccaaagaagctaacgttaatctcggggatctttatacgcgcaatctgcaacaa
cctggttctgcatctggctggcacaatattactttgtcattaaccgattgtccggttgaa
acaagtgcagtgacggcaatcgtgacaggttcaactgacaatacgggttattacaaaaat
gaaggtactgccgaaaatattcagatagagctgagggatgaccaggatgctgcgttaaaa
aatggcgatagcaaaacggttattgttgatgagatcactcgtaatgcacagtttccactt
aaggcaagagctatcacggtgaatggaaacgcaagccagggaacgatcgaggcgctaatc
aatgtgatctacacctggcaataa
              
                            

Download fasta file
RegulonDB