RegulonDB RegulonDB 10.9: Gene Sequence
ydeS gene sequence


Size: 531        A: 149  T: 144  G: 122  C: 116

Fasta

 

>ydeS E. coli K12. Version NC_000913.3 GI:556503834
atgaaatacaataacattattttcctcggtttatgtctggggttaaccacctattctgct
ttatccgcagatagcgttattaaaattagcgggcgcgtcctcgattatggctgcacagtc
tcatcggattcgcttaattttaccgtagatctccaaaaaaacagtgccagacaatttcca
acgaccggtagcacaagtccagccgtcccttttcagattacgttaagtgaatgcagcaaa
gggacaacgggggttcgggttgcatttaacggtattgaggatgcagaaaataatactttg
ttgaaactggatgaaggaagcaatacggcctccggtttgggtatagaaatattggacgca
aatatgcgtccggtgaaactgaatgatcttcatgccgggatgcagtggatcccactggta
ccagaacagaacaatattttgccttactccgctcgtctgaagtcaactcagaagtccgtc
aatccgggactggtgagggcttcggcaacctttacccttgaatttcaataa
              
                            

Download fasta file
RegulonDB