RegulonDB RegulonDB 10.9: Gene Sequence
lsrK gene sequence


Size: 1593        A: 374  T: 387  G: 442  C: 390

Fasta

 

>lsrK E. coli K12. Version NC_000913.3 GI:556503834
atggctcgactctttaccctttcagaatcaaagtactacctgatggcgctggatgcaggc
accggaagtattcgggctgtgatattcgacctggaaggcaatcaaatagcagtgggacag
gcggagtggcggcatctggcagtaccggacgttcctggttctatggaatttgatctcaac
aaaaactggcaactggcgtgtgagtgtatgcgccaggcgctgcacaacgccggcatagcc
ccggagtatatcgctgccgtttcggcatgttcgatgcgtgaaggcattgttttatataat
aatgaaggagccccgatctgggcctgcgccaatgtggatgccagagcggcacgcgaagtt
agcgaacttaaagaactgcacaacaatacctttgaaaacgaagtttatcgcgcgaccgga
caaacactggctttaagtgccatccccagattactttggctggcgcaccatcgttccgat
atttaccgtcaggcatcaaccatcaccatgatcagcgactggctggcctatatgctcagc
ggcgaactggcggtggatccctctaacgctggcaccacgggacttcttgatctaaccacc
cgtgactggaaacctgcattgctggatatggctggcctacgtgccgatattctttctcct
gtcaaagaaaccggcacattgctgggcgtggtaagttcacaagcggcggaactctgcggt
ctgaaggcgggcactccggtggtcgttggaggaggcgacgtgcagcttggttgccttggg
ttaggcgttgtgcgtccggcacaaaccgcggttcttggcggcacattctggcagcaagtt
gtaaatttagccgcgccggtgacagacccagaaatgaacgtgcgcgttaatcctcatgtt
attcctggcatggtacaagctgaatctataagcttttttaccggactcaccatgcgctgg
ttccgcgatgctttctgtgccgaagaaaaactgattgccgaacgtttaggcatcgacacc
tatacgctgctggaagagatggccagtcgggtgccgcctgggtcgtggggcgtaatgccg
atcttctccgacagaatgcgctttaaaacctggtatcacgctgcgccttcctttattaac
ttgtccattgacccggataaatgtaacaaagcgacattgttccgtgcgctggaagaaaat
gcggcgattgtatcagcgtgtaacttgcagcaaattgctgatttctcgaatattcatcct
tcatcgttagtctttgcaggcggaggttcaaaagggaaattatggagtcaaattctcgct
gatgtctcgggattacccgtcaatattccggtggtcaaagaagccactgcattaggatgt
gccattgcagctggcgtcggtgccggaattttttcatcaatggcagaaaccggagaacgc
ctggttcgctgggaacggacgcacacaccagacccggaaaagcatgaactttatcaggat
tcacgcgataagtggcaggcagtttatcaggatcagctggggctggttgatcatggactg
acgacgtcgttatggaaagcgcctgggttatag
              
                            

Download fasta file
RegulonDB