RegulonDB RegulonDB 10.9: Gene Sequence
lsrR gene sequence


Size: 954        A: 235  T: 235  G: 275  C: 209

Fasta

 

>lsrR E. coli K12. Version NC_000913.3 GI:556503834
atgacaatcaacgattcggcaatttcagaacagggaatgtgtgaagaagaacaggtcgcg
cggatcgcgtggttttactatcacgacgggctgacccagagcgagatcagcgatcgtctc
ggcctgacacgtttgaaagtgtcgcgattgctggagaaagggcatcagtccggcattatt
cgcgtacagattaattctcgctttgaaggctgtctggaatatgaaactcaattacgtcgt
cagttttcgctgcaacatgtccgggtgatccctgggcttgcggatgctgatgtcggtggg
cgactggggataggcgcggcgcatatgttgatgagtttacttcaaccacaacagatgctg
gcgattggttttggcgaggcaaccatgaatacgctgcaacgcttaagtggttttatttcg
tcacagcaaattcgcctggtcacgctctccggtggcgtcggttcttatatgacgggaatc
gggcagcttaacgcggcgtgcagtgtgaatattattccggctccgttgcgggcatcctcc
gctgacattgcccgtacgctaaaaaatgaaaattgcgtcaaagatgttctgttagccgcg
caagcagcggatgtggcgattgtcggcattggtgctgtgagtcaacaggacgatgcgaca
atcattcgctccggttatatcagccagggcgaacagttaatgattggccgaaaaggggcg
gttggcgacattttaggctacttttttgatgcaaaaggtgacgttgtcacgaatatcaaa
atacataacgaactgattggcttacctttaagcgcgctgaagaccatacccgtccgggtt
ggcgtggcagggggagaaaataaagccgaagcaattgccgctgcaatgaaaggcggttat
atcaacgcactggttaccgatcaggacacagcagcggcgattttacgtagttaa
              
                            

Download fasta file
RegulonDB