RegulonDB RegulonDB 11.0: Gene Sequence
glsB gene sequence


Size: 927        A: 203  T: 242  G: 275  C: 207

Fasta

 

>glsB E. coli K12. Version NC_000913.3 GI:556503834
gtggcagtcgccatggataatgcaattttagaaaacatcttgcggcaagtgcggccgctc
attggtcagggtaaagtcgcggattatattccggcgctggctacagtagacggttcccga
ttggggattgctatctgtaccgttgacggacagctttttcaggccggagacgcgcaagaa
cgtttttccattcagtctatttccaaagtgctgagtctcgttgtcgccatgcgtcattac
tccgaagaggaaatctggcaacgcgtcggcaaagatccgtctggatcaccgttcaattcc
ttagtgcaactggaaatggagcagggtataccgcgtaatccgttcattaatgccggtgcg
ctggtggtctgcgatatgttgcaagggcgattaagcgcaccacggcaacgtatgctggaa
gtcgtgcgcggcttaagcggtgtgtctgatatttcctacgatacggtggtagcgcgttcc
gaatttgaacattccgcgcgaaatgcggctatcgcctggctgatgaagtcgtttggcaat
ttccatcatgacgtgacaaccgttctgcaaaactactttcattactgcgctctgaaaatg
agctgtgtagagctggcccggacgtttgtctttctggctaatcaggggaaagctattcat
attgatgaaccagtggtgacgccaatgcaggcgcggcaaattaacgcgctgatggcgacc
agtggtatgtaccagaacgcgggggagtttgcctggcgggtggggctaccggcgaaatct
ggcgttggtggcggtattgtggcgattgttccgcatgaaatggccatcgctgtctggagt
ccggaactggatgatgcaggtaactcgcttgcgggtattgccgttcttgaacaattgacg
aaacagttagggcgttcggtttattaa
              
                            

Download fasta file
RegulonDB