RegulonDB RegulonDB 10.10: Gene Sequence
sad gene sequence


Size: 1389        A: 331  T: 321  G: 425  C: 312

Fasta

 

>sad E. coli K12. Version NC_000913.3 GI:556503834
atgaccattactccggcaactcatgcaatttcgataaatcctgccacgggtgaacaactt
tctgtgctgccgtgggctggcgctgacgatatcgaaaacgcacttcagctggcggcagca
ggctttcgcgactggcgcgagacaaatatagattatcgtgctgaaaaactgcgtgatatc
ggtaaggctctgcgcgctcgtagcgaagaaatggcgcaaatgatcacccgcgaaatgggc
aaaccaatcaaccaggcgcgcgctgaagtggcgaaatcggcgaatttgtgtgactggtat
gcagaacatggtccggcaatgctgaaggcggaacctacgctggtggaaaatcagcaggcg
gttattgagtatcgaccgttggggacgattctggcgattatgccgtggaattttccgtta
tggcaggtgatgcgtggcgctgttcccatcattcttgcaggtaacggctacttacttaaa
catgcgccgaatgtgatgggctgtgcacagctcattgcccaggtgtttaaagatgcgggt
atcccacaaggcgtatatggctggctgaatgccgacaacgacggtgtcagtcagatgatt
aaagactcgcgcattgctgctgtcacggtgaccggaagtgttcgtgcgggagcggctatt
ggcgcacaggctggagcggcactgaaaaaatgcgtactggaactgggcggttcggatccg
tttattgtgcttaacgatgccgatctggaactggcggtgaaagcggcggtagccggacgt
tatcagaataccggacaggtatgtgcagcggcaaaacgctttattatcgaagagggaatt
gcttcggcatttaccgaacgttttgtggcagctgcggcagccttgaaaatgggcgatccc
cgtgacgaagagaacgctctcggaccaatggctcgttttgatttacgtgatgagctgcat
catcaggtggagaaaaccctggcgcagggtgcgcgtttgttactgggcggggaaaagatg
gctggggcaggtaactactatccgccaacggttctggcgaatgttaccccagaaatgacc
gcgtttcgggaagaaatgtttggccccgttgcggcaatcaccattgcgaaagatgcagaa
catgcactggaactggctaatgatagtgagttcggcctttcagcgaccatttttaccact
gacgaaacacaggccagacagatggcggcacgtctggaatgcggtggggtgtttatcaat
ggttattgtgccagcgacgcgcgagtggcctttggtggcgtgaaaaagagtggctttggt
cgtgagctttcccatttcggcttacacgaattctgtaatatccagacggtgtggaaagac
cggatctga
              
                            

Download fasta file
RegulonDB